ID: 950866419

View in Genome Browser
Species Human (GRCh38)
Location 3:16192994-16193016
Sequence ATTCCTGGTTTTGCTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950866419 Original CRISPR ATTCCTGGTTTTGCTCATTG TGG Intronic
902796183 1:18801819-18801841 ATTACTGGTTTTGCTGTTGGTGG - Intergenic
904466291 1:30709744-30709766 ATTGCTGTTCTTGCTCACTGAGG - Intergenic
906277939 1:44531892-44531914 GTTCTTGGTTTGGCTCATAGGGG + Intronic
909117641 1:71558831-71558853 ATTCCTGGTTTCTGTTATTGAGG + Intronic
909206843 1:72769404-72769426 ATTCCTGACTTTGCTCCATGTGG - Intergenic
909890070 1:80994313-80994335 TGTCCTGGTTTTGCTCCTTTGGG - Intergenic
910383949 1:86661495-86661517 CTTCCAGTTTTTGCTCATTCAGG - Intergenic
910423671 1:87098560-87098582 ATTCCTTGTATTTCTCATTATGG - Intronic
911838416 1:102650573-102650595 ATTTCTGGTTTAGATCCTTGAGG + Intergenic
912153934 1:106892575-106892597 ATTGCTGCTTTTGATCATAGAGG + Intergenic
912772349 1:112476417-112476439 ATTCGTTGTTTTTCTCAGTGGGG - Intronic
913333540 1:117686838-117686860 ATTCCTTGTTTTGCTTATTGAGG - Intergenic
914756661 1:150566018-150566040 ATTCAAGGTTTGGATCATTGAGG - Intergenic
916468413 1:165095298-165095320 ATTCCTTGCTTTGTTCATTTGGG - Intergenic
916476251 1:165171953-165171975 ATTCCTTGATGTGCTCACTGAGG + Intergenic
917085560 1:171302073-171302095 ATTTCTGATTTTGTTTATTGGGG - Intergenic
917092099 1:171363582-171363604 CTTCCAGCTTTTGCTCATTCAGG - Intergenic
918262735 1:182810392-182810414 GTTCCTGGTTTTACTCTTTGAGG + Intronic
920794377 1:209124407-209124429 ATTGCTGGTTTTGATGAATGTGG + Intergenic
921841372 1:219832208-219832230 ATTTCTGGTTTAGATCCTTGAGG - Intronic
922677190 1:227560416-227560438 ATGGGTGGTTTTGCTCATGGTGG + Intergenic
923662944 1:235974521-235974543 ATTGCTGCTTTTGATCCTTGAGG - Intergenic
924068417 1:240250944-240250966 ATTTCTGATTTTGTTCATTTGGG + Intronic
924928963 1:248710166-248710188 ATTCCTGGCTAATCTCATTGTGG + Intergenic
1063873320 10:10444112-10444134 ATTCCTACTTATGCTCAGTGTGG + Intergenic
1064331806 10:14401188-14401210 CTTCCTGGATTTCCTCACTGAGG + Intronic
1064547680 10:16467103-16467125 ATCCATGGTTTTGCTTTTTGTGG + Intronic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1066263698 10:33754100-33754122 ATTCATGGTTTTGCTTTCTGTGG + Intergenic
1066479791 10:35784642-35784664 AGTTCAGGGTTTGCTCATTGTGG - Intergenic
1070832082 10:79424255-79424277 CTTTCCTGTTTTGCTCATTGTGG + Intronic
1071099543 10:82019031-82019053 CTTCCAGTTTTTGCCCATTGAGG + Intronic
1073165596 10:101446847-101446869 ATTCCTGGTTTAGATCTTTGGGG - Intronic
1073571690 10:104585899-104585921 ATCCCTAGTTTTGCTCATTTTGG + Intergenic
1074534867 10:114321534-114321556 ATTCCTGGTCCTGCTCTTTATGG + Intronic
1075350305 10:121718524-121718546 AGTCCAGGTTCTGCTGATTGTGG - Intergenic
1075610841 10:123853400-123853422 AATCCTTGTTTTGGTCATTTAGG + Intronic
1075757941 10:124830474-124830496 ATTCCTCTTTTTACTCACTGAGG - Intronic
1077939060 11:6820055-6820077 ATTGCTGCTTTTACTCATGGTGG - Intergenic
1079670324 11:23161782-23161804 ATTTCTAGATTTGCTTATTGTGG - Intergenic
1080085404 11:28275242-28275264 ATTTCTGGTTTTGTTTATTTGGG - Intronic
1080145597 11:28979124-28979146 CTTCCAGTTTTTGCTCATTAAGG - Intergenic
1081244641 11:40749752-40749774 ATTTCTGGTTTTGTTTATTTGGG - Intronic
1082774289 11:57234035-57234057 ATTCCGGGTTTTGTTCTTGGAGG - Exonic
1083311848 11:61787825-61787847 ATTCCTGGGCTTCCTCAATGGGG + Exonic
1086578272 11:88365439-88365461 ATTCCTGGTTTTCCTTATGTAGG - Intergenic
1088307036 11:108421732-108421754 ATTCCTGGTGTGGCTTTTTGGGG - Intronic
1089514769 11:119025515-119025537 GTCCCTGGGTTTGCTCAATGTGG - Intronic
1091598129 12:1894032-1894054 ATTTCTGATTTTGTTCATTTGGG - Intronic
1091911758 12:4237199-4237221 ATTTCTGATTTTGCTTATTTGGG + Intergenic
1093361321 12:18232578-18232600 ATTTCTGGTTTTGTTTATTTGGG + Intronic
1093571866 12:20675243-20675265 ATTTCTAGTTTTATTCATTGTGG + Intronic
1093976739 12:25431272-25431294 TTTCTTGATTTTGATCATTGTGG - Intronic
1094773067 12:33688810-33688832 ATTTCTGGTTTTCCTCTTTATGG + Intergenic
1096204715 12:49711460-49711482 ATGTCTGGCTTTGCTCTTTGTGG + Intronic
1096534764 12:52264258-52264280 AGTCCTGGTTGTGCACATGGTGG - Intronic
1098495311 12:71127802-71127824 TTTTCTGGTTTTGCTAACTGAGG + Intronic
1099612532 12:84892651-84892673 ATCCCTGATTTTGTTCCTTGTGG + Intronic
1100652433 12:96604999-96605021 GTACCTGGTTTATCTCATTGGGG - Intronic
1100740585 12:97587276-97587298 ATTTCTGGTTTAGATCCTTGAGG - Intergenic
1101341441 12:103845354-103845376 TTTCCTGGGTTTGATTATTGTGG + Intergenic
1102311257 12:111846226-111846248 ATTCATTGTTTTGCTTTTTGGGG + Intronic
1103218049 12:119218753-119218775 CTTGCTGGTTTTGCTGCTTGGGG - Intronic
1103418533 12:120761113-120761135 ATGTCTGGTTTTGTTCACTGGGG + Intergenic
1106692426 13:32132633-32132655 ATTCTAGGTTTTGCTATTTGAGG - Intronic
1107345624 13:39457642-39457664 ATACCTGATTTTTGTCATTGTGG - Intronic
1108576530 13:51796137-51796159 AGTCCTGGTTTTGCACTTTCTGG - Intronic
1109153952 13:58880742-58880764 TTTCATGGTTTTGCTTATTGAGG + Intergenic
1109887632 13:68563029-68563051 ATCTTTGGTTTTGCTCATTTTGG + Intergenic
1110123558 13:71913138-71913160 ATTCCTGGAATGCCTCATTGAGG + Intergenic
1110889134 13:80676457-80676479 ATTTCTAGTTTTTTTCATTGTGG + Intergenic
1111791638 13:92863892-92863914 ATTCATAGTTTTGCTCTTAGTGG - Intronic
1114279113 14:21174384-21174406 CTTCCTGCTTTTGCCCATTCAGG - Intergenic
1114914703 14:27248749-27248771 ATTTCTGGTTTAGATCCTTGAGG + Intergenic
1115393308 14:32877932-32877954 ATTTCTGATTTTGCTTATTTGGG + Intergenic
1116506326 14:45686844-45686866 ATTTCTGGTTTTACTCCATGTGG + Intergenic
1117018357 14:51542332-51542354 ATCCATGGATTTGCTCATTCTGG + Intronic
1117270801 14:54141559-54141581 ATTTCATGTTTTGCTGATTGTGG - Intergenic
1118562777 14:67104713-67104735 ATTTCTGATTTTGCTTATTTGGG + Intronic
1119054887 14:71409144-71409166 ATTCTTAGTTTTGCCCATTTGGG + Intronic
1119063015 14:71495486-71495508 ATTCCTGATTTTGGTAATTTTGG + Intronic
1119084777 14:71729886-71729908 ATTCTTGGGTTAGCTCCTTGAGG + Intronic
1120353482 14:83395496-83395518 GATCCTGCTTTTTCTCATTGAGG + Intergenic
1121551583 14:94806865-94806887 CTTCCTGCTTTTGCTCCTGGAGG - Intergenic
1124687980 15:31798618-31798640 ACTCCTGGTTATCCTCAGTGAGG - Intronic
1124717289 15:32076132-32076154 TTTTCTGCTTTTGTTCATTGGGG + Intronic
1126554587 15:49971719-49971741 ATTTCTGGTTTAGATCCTTGAGG - Intronic
1126930821 15:53648952-53648974 ATAACTGGTTTTGCTCAATTTGG - Intronic
1126984228 15:54284523-54284545 ATTCATGTTTTTCCTCATTAAGG - Intronic
1127219517 15:56863731-56863753 ATTCCTTTTTTTGCTTATTTTGG - Intronic
1127896681 15:63306422-63306444 ATTCCAGGTTTTGCTTTCTGAGG + Exonic
1128598760 15:68977277-68977299 CTTTCTGGTTTTGCAGATTGGGG - Intronic
1128862685 15:71087412-71087434 ATTTCTGATTGTGCTCATTTGGG - Intergenic
1130199465 15:81811404-81811426 TTTCCTGGATTGGCTCATTTGGG - Intergenic
1131561744 15:93449669-93449691 CTTCCTGGTTTTTCTGCTTGTGG - Intergenic
1131580381 15:93637010-93637032 ATTTCTGGTTTGGGTCTTTGAGG + Intergenic
1132095942 15:98984966-98984988 ATTCCTGGTAGTGCTCCTTGCGG + Intronic
1132399264 15:101495561-101495583 CATCCTGGTTTTGCTCAATCTGG - Intronic
1133175665 16:4012177-4012199 CTTCCCGATTTTGCTCGTTGTGG - Intronic
1135028920 16:19021672-19021694 ATTCCTGGTGTTGCTGAATTTGG + Exonic
1135301178 16:21328784-21328806 CTTCCTGGTTTTGCGGCTTGTGG + Intergenic
1135343345 16:21667071-21667093 CTTCCTGGTTTGGGTCATTTGGG - Intergenic
1137377688 16:47967598-47967620 CTACCTGGATTTGGTCATTGAGG + Intergenic
1138311668 16:56029055-56029077 ATACCTGGTGTCTCTCATTGAGG - Intergenic
1138361890 16:56437335-56437357 ATTCCTATTTTTGCTAATGGTGG - Intronic
1140474228 16:75230746-75230768 CCTATTGGTTTTGCTCATTGTGG - Intronic
1140771349 16:78206987-78207009 ATTCCTTGTTATCCTCATTTTGG + Intronic
1141377348 16:83543891-83543913 AGTCTTGGTCTTGCCCATTGAGG - Intronic
1141412939 16:83848027-83848049 TTTCCTGCTAATGCTCATTGCGG - Intergenic
1141785214 16:86195102-86195124 ATCCCTGGCTTTGCTAATTGGGG + Intergenic
1141905707 16:87025506-87025528 ATTTTTGTTTTTGATCATTGAGG + Intergenic
1143289212 17:5816410-5816432 ATTCCTGGGTTTGCACTGTGGGG + Intronic
1144197843 17:12912712-12912734 ATTGCTGCTTTTGCTCAGTCTGG - Intronic
1144562201 17:16330037-16330059 CTTCCTGCTTTTGCTCCTTCTGG - Intronic
1147535771 17:41322167-41322189 AATCCTAGTTTTCCTAATTGGGG + Intergenic
1151902547 17:77026207-77026229 ATTCCTGCTATCCCTCATTGTGG - Intergenic
1152793463 17:82294137-82294159 ATACCTGGTTTTGCTGTTGGAGG + Intergenic
1153652679 18:7255154-7255176 CTTCATCTTTTTGCTCATTGAGG - Intergenic
1155106735 18:22674480-22674502 CTTCCTTGTTTTGCCCATGGTGG - Intergenic
1155190131 18:23422362-23422384 GTTTCTGGTTTGGCTGATTGGGG - Intronic
1156997305 18:43483094-43483116 ATTCCTGGTTTTTGTGAGTGTGG + Intergenic
1157109569 18:44807915-44807937 ATTCCTTGGTTTGCTCCTTCTGG - Intronic
1157555938 18:48612893-48612915 CTTCCTGGGTTTCCTCAGTGGGG + Intronic
1158468893 18:57716982-57717004 ATTTCTAGTTTTACTCATTGTGG - Intronic
1159078992 18:63714192-63714214 ATTGCTGGTTTTGCGGCTTGGGG - Intronic
1159506750 18:69348271-69348293 ATTTCTGGTTTAGATCCTTGAGG - Intergenic
1159565386 18:70042323-70042345 ATTCCTGGTTTTTCTCTTCCTGG - Intronic
1159990907 18:74906139-74906161 ATTCCTGGTTTTTGTCCTGGAGG + Intronic
1160600951 18:80012232-80012254 ATTCCTGGTTTTTCTAATATAGG + Intronic
1162354475 19:10173124-10173146 GTTCCTGATTTTGCTCTTTCAGG + Exonic
1162849330 19:13418510-13418532 ATTCCTGGATTTTCTGAGTGGGG + Intronic
1164844579 19:31420957-31420979 AGTCCAGGTTTTGATCATGGAGG - Intergenic
1165636357 19:37343574-37343596 ATTCCTGGTTCTTCTCCATGTGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165733122 19:38159079-38159101 ATTGATGGTTTTCCTCTTTGGGG - Intronic
1165836811 19:38762582-38762604 ATTCTTGCTTTTGGTAATTGAGG - Intronic
1168230994 19:55031557-55031579 AATTCTGGTTTTTTTCATTGTGG + Intronic
925136026 2:1525363-1525385 ATTTGTGGTTTTGCTCACAGTGG - Intronic
925136274 2:1526307-1526329 ATTTGTGGTTTTGCTCACAGTGG - Intronic
925136753 2:1528276-1528298 ATTTGTGTTTTTGCTCACTGTGG - Intronic
925233049 2:2252774-2252796 ATCCCTGGGTGTGCTCAGTGGGG + Intronic
925486091 2:4332999-4333021 ATGCCTGCTTTTGGTCTTTGAGG + Intergenic
926053473 2:9759459-9759481 ACCCCTGGTTTTGCCCCTTGTGG - Intergenic
926588491 2:14715157-14715179 ATTCCTGGCATGGCTCACTGTGG - Intergenic
926992962 2:18699505-18699527 ATTCATGGTTTTACTTTTTGTGG + Intergenic
928056711 2:28063670-28063692 ATTTTTGGTTTTGGTCCTTGAGG + Intronic
928880903 2:36095381-36095403 ATTTCTGGTTTTGATCCTTGAGG - Intergenic
929038340 2:37718834-37718856 ATTCCTGGTTTTGTGCATTTGGG + Intronic
930223597 2:48769427-48769449 ATTCCTCCTTTTCCCCATTGTGG - Intronic
930253909 2:49067018-49067040 CTTCCGGGTTTACCTCATTGAGG - Intronic
930277192 2:49325672-49325694 ATTGCTGCTTTTGATCATGGAGG + Intergenic
931903804 2:66821063-66821085 ATTCCTGGTTAGGGTTATTGGGG + Intergenic
932126375 2:69148909-69148931 TTTCCTGGTTCTGCTCAATGGGG + Intronic
938091955 2:128440191-128440213 ATTCCTGGTTGTCCCCATGGTGG - Intergenic
939942580 2:148367924-148367946 ATTTCTGGTTTAGATCCTTGAGG - Intronic
940484812 2:154284737-154284759 ATTCCAGTTTTAGCTTATTGAGG + Intronic
942581746 2:177426487-177426509 CTTCCAGCTTTTGCTCATTCTGG + Intronic
942717926 2:178915228-178915250 ATTCCTGGTTAAAATCATTGAGG - Intronic
943171571 2:184407494-184407516 CTTCCTGGTTTTGCAGCTTGGGG + Intergenic
947010375 2:225559406-225559428 ATTTCTGCTTTTTCTAATTGAGG - Intronic
947058195 2:226131845-226131867 ATTGCTGGTGTTGCTGAATGGGG - Intergenic
947064003 2:226199415-226199437 ATTTCTGGTTTAGCTGATTGAGG + Intergenic
947553732 2:231068484-231068506 ATCCATGGTTTTGCTCTCTGTGG + Intronic
947831210 2:233143094-233143116 AATCCTTGTTTTGCTGATGGGGG - Intronic
948270670 2:236670888-236670910 GTTCCTGGTTGTGGTCTTTGTGG + Intergenic
1170410502 20:16085067-16085089 ATTCCTGATTTTGTTTATTTGGG - Intergenic
1171235127 20:23518588-23518610 ATTCCTGATTCTGCTCACTTGGG - Intergenic
1172112427 20:32554943-32554965 AGTCCTTGGTTTCCTCATTGGGG - Intronic
1172483054 20:35282940-35282962 TTTCTTAGTTCTGCTCATTGAGG - Intronic
1177588812 21:23135176-23135198 CTTGCTGGTTTTGCTGCTTGGGG - Intergenic
1177591956 21:23183015-23183037 ATTCCTAATATTGGTCATTGTGG - Intergenic
1178739346 21:35183327-35183349 ATTTCTGGTTTAGATCCTTGAGG + Intronic
1179489749 21:41733720-41733742 AATGCTTGTTTAGCTCATTGTGG + Intergenic
1182043685 22:27258138-27258160 CTTTCTGGTTTTGCTCATCTGGG - Intergenic
1183083366 22:35471527-35471549 AGTCCTGGCTTTGCCCCTTGGGG + Intergenic
1183325116 22:37187222-37187244 GTTCCTGGTTCTGCTCAATAAGG + Intronic
949479116 3:4476714-4476736 ATTGTTGGTTTTGCACATGGAGG + Intergenic
950043790 3:9937102-9937124 ATTCCATGTTTTACTTATTGAGG + Intronic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
950927619 3:16758565-16758587 ATTCCTAGATTTGCCCTTTGAGG + Intergenic
951057790 3:18168105-18168127 ATTTCTGGTTTTGATAATGGAGG - Intronic
951664559 3:25107962-25107984 ATCCCTACTTTTGCACATTGGGG + Intergenic
952442434 3:33345705-33345727 ATTTCTAGTTTAACTCATTGTGG - Intronic
953495270 3:43380776-43380798 ATGCCTTGTTTTTTTCATTGTGG - Intronic
953730693 3:45445016-45445038 ATTCCTAGACTTGGTCATTGTGG - Intronic
953892608 3:46764821-46764843 ATTGCTGCTTTTGATCACTGAGG + Intronic
955919904 3:63944635-63944657 ATTCATGGTTTTGCTTTCTGAGG - Intronic
956273872 3:67476891-67476913 ATCCCTGGTTTTGCTAAGTATGG - Intronic
957844765 3:85717587-85717609 ATTCCAGCTTTTGCCCATTCAGG + Intronic
958914781 3:100037171-100037193 TTTCCTGATTTTGATCATTGTGG + Intronic
959743710 3:109751672-109751694 ATGAATGGTTTTGCTGATTGTGG + Intergenic
961698198 3:128721258-128721280 ATTGCTGGTTTTGCGGCTTGTGG + Intergenic
962264778 3:133937011-133937033 AGGCCTGGGTTTTCTCATTGTGG + Intronic
962551762 3:136500370-136500392 ATTCCTGGTTATTTTCATTCTGG + Intronic
962906845 3:139811453-139811475 ATTCCTGGTTTAGATCTTTGTGG + Intergenic
964251630 3:154724435-154724457 AATCCTGGTTTTGCTTCATGGGG + Intergenic
964716470 3:159727881-159727903 ATTCCTGTTTCTGCTCTTTCAGG + Intronic
964997052 3:162894759-162894781 ATTTCTGGTTTTATTCATTTGGG - Intergenic
967325692 3:188236775-188236797 AGTCCTGCTTTTGCTGATGGAGG + Intronic
971016592 4:22495461-22495483 ATTCATGGTTTTGCTTTCTGTGG - Intronic
971702355 4:29994785-29994807 AGTCCAAGTTTTGCTCCTTGGGG + Intergenic
971704793 4:30026368-30026390 TTTCTTGGTTTTGGTCATTTGGG + Intergenic
971784792 4:31086077-31086099 ATTCCTGGTTTTGCTTTGTTTGG + Intronic
971832981 4:31721937-31721959 ATTAATGGTCCTGCTCATTGTGG - Intergenic
971899894 4:32646177-32646199 ATTGCTGGTTTTGCGGCTTGGGG + Intergenic
972463648 4:39330537-39330559 ACTCCTGGTCTAGCTGATTGTGG - Intronic
973342393 4:49018482-49018504 ATTCTTGATTTTGCACATTATGG + Intronic
973818158 4:54637907-54637929 TTTACTGGTTTTGGTCATTACGG + Intergenic
973989452 4:56389338-56389360 CTTGTTGGTTTTGCTCACTGGGG + Intergenic
974585182 4:63864738-63864760 ATTTCTTTTTTTTCTCATTGTGG - Intergenic
975748025 4:77493660-77493682 ATTCCCCTTTTGGCTCATTGTGG + Intergenic
976115665 4:81723085-81723107 ATTCCTGGCTTTTCTCCCTGTGG - Intronic
976363371 4:84206196-84206218 CTTGCTGGTTTTGCTGTTTGAGG - Intergenic
977011000 4:91633193-91633215 ATTGCTATTTTTGCTCTTTGGGG - Intergenic
977458419 4:97293634-97293656 ATTTCTAGTTTTATTCATTGTGG + Intronic
977627761 4:99206206-99206228 ATTCTTTCTTTTGCACATTGTGG + Intronic
978230905 4:106397492-106397514 ATTGCTGCTTTTGATCATTGAGG - Intergenic
978369752 4:108018368-108018390 TTTCTTGCTTTTGGTCATTGGGG - Intronic
978623491 4:110658403-110658425 AAACTTGGTTTTGCTCTTTGTGG + Intergenic
979141067 4:117175328-117175350 ATTTCTGGTTTAGATCCTTGAGG - Intergenic
979495413 4:121377711-121377733 AATCCTGTTTTTGCTCATTTTGG + Intronic
981444094 4:144814994-144815016 ATTTCTGATTTTGTTCATTTGGG - Intergenic
982014957 4:151144527-151144549 CTTCCTGGTTATGGTCATTAAGG - Intronic
982455042 4:155599392-155599414 TTTCCTGGTTTTGTTTTTTGGGG + Intergenic
984071053 4:175113102-175113124 ATTTCTGATTTTACTCATTTGGG - Intergenic
984202039 4:176735583-176735605 ATTCCTATTTTTGCCCATTCTGG + Intronic
984428685 4:179620840-179620862 ATGCTTGATTTTTCTCATTGTGG + Intergenic
984552807 4:181181152-181181174 ATTCCTGTATTTTTTCATTGTGG - Intergenic
984892619 4:184507172-184507194 ATTCCTTGTTTTGCTCAAGGTGG + Intergenic
985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG + Intronic
986511862 5:8515993-8516015 TTTTCTGATTTTGATCATTGTGG - Intergenic
987940817 5:24533576-24533598 AGTAATAGTTTTGCTCATTGTGG + Intronic
988131457 5:27112068-27112090 CTTCCAGCTTTTGCTCATTCAGG - Intronic
988146024 5:27309739-27309761 ATTCCTTTTTGAGCTCATTGAGG - Intergenic
988919450 5:35926879-35926901 ATTCCTGGTTTTCCTTTTTCAGG + Intronic
989318950 5:40112606-40112628 CTTACTGGTTTTGCCAATTGTGG + Intergenic
989367263 5:40670664-40670686 ATTCCCGGGTTTGCTGATTCAGG + Intergenic
989771571 5:45152400-45152422 CTTGCTGGTTTTGCTGCTTGGGG + Intergenic
992229368 5:74648882-74648904 ATTCCTGGTTTTGTTGAGGGTGG - Intronic
993442633 5:87975331-87975353 TTTTCTGGTTTTGCTTATTTTGG + Intergenic
993756705 5:91739926-91739948 TTTGTTGGTTTTGCTCACTGTGG - Intergenic
997183941 5:131862303-131862325 ATTCCTGATTTTGTTTATTTGGG + Intronic
998344124 5:141446307-141446329 ATTCCTGGGTTTCCACATTAAGG + Intronic
998752927 5:145343796-145343818 ATTTCTGATTTTGCTTATTTGGG - Intergenic
999796721 5:154995744-154995766 ATTCCTGGCTTCGCTCCTAGAGG - Intergenic
999798213 5:155007774-155007796 TTTCCTGGGTTTGCTCATCCAGG + Intergenic
1000717990 5:164670294-164670316 ATTCTAGGTTTTGCACTTTGGGG + Intergenic
1001214608 5:169844145-169844167 ATTCCAGGTTTTTCTCATTATGG - Intronic
1002588660 5:180271294-180271316 ATTCCTGGTTGTGGTTATTGCGG + Intronic
1003609479 6:7596693-7596715 ATTCCAGGTTTTTTTCTTTGAGG + Intronic
1005149958 6:22737488-22737510 ATTCCTGGCTTTGGCCTTTGCGG - Intergenic
1005997038 6:30937931-30937953 ATTGCTGTTTTTGCTCAAAGAGG + Intergenic
1009527813 6:64768760-64768782 AGTCAGGGCTTTGCTCATTGAGG - Intronic
1010180186 6:73077276-73077298 ATTCCTGGTCGTGCTAACTGTGG + Intronic
1011199368 6:84818117-84818139 ATTTCTGGTTTAGGTCCTTGAGG + Intergenic
1011504154 6:88022670-88022692 ATTCCTGGTTATCTGCATTGTGG - Intergenic
1012115649 6:95294385-95294407 ATTCATGGTTTTGCTGAATAAGG - Intergenic
1013438902 6:110141099-110141121 ATTCATGGTTTTGCTTTCTGTGG - Intronic
1014976136 6:127886525-127886547 ATTCCTGTTTTTGTTCACTTGGG + Intronic
1015351954 6:132230411-132230433 ATTCCTGATTATGCAAATTGTGG - Intergenic
1015941263 6:138454545-138454567 AATCCTGGTTTTGCTTTTAGGGG + Intronic
1017502742 6:155040462-155040484 AATCCTGGTTTTGGTAATGGTGG + Intronic
1018144048 6:160866245-160866267 ATTCATGGTTTTGCTTTCTGTGG + Intergenic
1018210893 6:161480563-161480585 ATTCCTGGTTCTGGGCTTTGGGG + Intronic
1018804921 6:167251265-167251287 ATTCCAGGCTTTGTTCATTCTGG - Intergenic
1021628522 7:22620553-22620575 AATCCTAGTTTTTCTTATTGTGG + Intronic
1027793132 7:82658066-82658088 ATTCCAGGTTTTGCTTTCTGAGG + Intergenic
1028721742 7:94040673-94040695 ATTCCGTGTTTTTCTCATTATGG - Intergenic
1029290385 7:99497981-99498003 CTTCCTGGTTTTGCTTTCTGCGG - Intronic
1031257714 7:119477628-119477650 ATTCTTGGTTTTGGTCGTGGGGG + Intergenic
1032046450 7:128613426-128613448 ATTCCTGTTTTTATTCATTTGGG + Intergenic
1034891669 7:154845017-154845039 AGTCCTGGTTTTTCTAATTCAGG - Intronic
1037252602 8:16914428-16914450 AATCCTTATTTTGCTCAATGTGG + Intergenic
1038814170 8:30883893-30883915 ATTTCTGGTTCTGATCCTTGAGG + Intronic
1039380789 8:37083114-37083136 CTTCCTGGTCTTGTTCTTTGTGG - Intergenic
1041925646 8:63233584-63233606 ATTCCTGGTTTTGGTTATTTGGG - Intergenic
1042052062 8:64721315-64721337 ATTCCTGGCTTTGCTCAAACAGG + Intronic
1043121371 8:76329411-76329433 TTTCCTGGTTTTGGTTATTAGGG + Intergenic
1043127313 8:76415261-76415283 ATTCATGGTTTTGCTTTCTGTGG - Intergenic
1043764554 8:84114003-84114025 TTTACTTGTTTTGCTTATTGGGG + Intergenic
1044440239 8:92215452-92215474 ATTTCTGGTTCTGATCCTTGAGG + Intergenic
1045646968 8:104308685-104308707 ATATCTGGTTCTTCTCATTGGGG + Intergenic
1045749464 8:105465056-105465078 ATTCTTGATTTTGCCCTTTGAGG + Intronic
1045826624 8:106405288-106405310 TTTCCTGGATTTGCACCTTGTGG - Intronic
1046302226 8:112310940-112310962 ATTCATGTTTTTGTTCATTTTGG + Intronic
1046322022 8:112591750-112591772 ATACATGATTTTGCTCATAGAGG + Intronic
1046590233 8:116197537-116197559 ATGTCTGATTTTGCTCATTTAGG - Intergenic
1048026341 8:130590442-130590464 ATTCCCAGTTTTGTTCAATGTGG + Intergenic
1048106135 8:131411974-131411996 ATACTTGGTTTTACTTATTGGGG - Intergenic
1050630418 9:7552710-7552732 CTTCCAGCTTTTGCCCATTGTGG - Intergenic
1051812913 9:21070509-21070531 ACTCCTGGTTTTGCTCCAAGTGG - Intergenic
1060446898 9:123697734-123697756 GTTCCTGGTTTTTCGCATTGAGG - Intronic
1061815683 9:133193543-133193565 ATTCCTTCTTTTTCACATTGTGG + Intergenic
1186252835 X:7687588-7687610 TTTCCTCATTTTCCTCATTGTGG + Intergenic
1187644774 X:21335159-21335181 CTTCCTGGTTTTGCGGCTTGGGG + Intergenic
1190133279 X:47770625-47770647 GTTCCTCTTTTTGCTCTTTGAGG - Intergenic
1190561022 X:51685181-51685203 ATTCCTGGTTCTTCACATGGTGG + Intergenic
1190563269 X:51708140-51708162 ATTCCTGGTTCTTCACATGGTGG - Intergenic
1191148436 X:57193547-57193569 ATTGCTGGTTTTGCAGCTTGTGG + Intergenic
1192770370 X:74182986-74183008 ATTTCTGGTTCTGGTCTTTGAGG - Intergenic
1193017149 X:76748153-76748175 TTTCTAGGTTTTGTTCATTGTGG - Intergenic
1194401365 X:93440869-93440891 ATTCCTGATTTTGCTTATTTGGG - Intergenic
1194671064 X:96733318-96733340 TTTCAAGGTTTTGCTCAGTGAGG - Intronic
1195270614 X:103225885-103225907 AGTTCTGGTTTTGTTCCTTGAGG - Intergenic
1195660877 X:107376590-107376612 ATTTCTGGTTCTGATCCTTGAGG + Intergenic
1195847612 X:109245099-109245121 CTTCCGGGTTTTGCCCATTCAGG + Intergenic
1196020003 X:110981418-110981440 TTTCCTGATTTTGATAATTGTGG + Intronic
1196924978 X:120624620-120624642 ATTTCTGATTATTCTCATTGAGG - Intergenic
1199553232 X:149079389-149079411 ATTCCTGGTTTTCGCCAGTGTGG + Intergenic
1199903615 X:152202741-152202763 ATTTTTGGTTTTGCTCTATGAGG - Intronic
1201364896 Y:13193531-13193553 ATTCCTAGCTTTGTACATTGTGG + Intergenic
1202340403 Y:23858561-23858583 CTTGTTGGTTTTGCTGATTGAGG + Intergenic
1202530363 Y:25811521-25811543 CTTGTTGGTTTTGCTGATTGAGG - Intergenic