ID: 950867069

View in Genome Browser
Species Human (GRCh38)
Location 3:16197590-16197612
Sequence GTTGCCCTGAGCCACCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950867065_950867069 23 Left 950867065 3:16197544-16197566 CCTACTCTACCTGTGAGGAAAAC 0: 1
1: 0
2: 2
3: 15
4: 195
Right 950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG 0: 1
1: 0
2: 0
3: 16
4: 138
950867066_950867069 14 Left 950867066 3:16197553-16197575 CCTGTGAGGAAAACTGAGACAGA 0: 1
1: 0
2: 5
3: 43
4: 340
Right 950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG 0: 1
1: 0
2: 0
3: 16
4: 138
950867064_950867069 24 Left 950867064 3:16197543-16197565 CCCTACTCTACCTGTGAGGAAAA 0: 1
1: 0
2: 2
3: 24
4: 220
Right 950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG 0: 1
1: 0
2: 0
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950867069 Original CRISPR GTTGCCCTGAGCCACCTTGA TGG Intronic
902157679 1:14502725-14502747 GTTGCTCTGACCCACCTTGCAGG - Intergenic
902408888 1:16201631-16201653 GTAGCTCTGAGGAACCTTGAAGG - Intronic
904114351 1:28150635-28150657 GTTGGCCTGAGCAGTCTTGATGG + Exonic
904984334 1:34532437-34532459 GCTCTCCTGAGCTACCTTGATGG + Intergenic
917656853 1:177135201-177135223 GTGGCCCTGAACCAGCTCGATGG + Intronic
918100239 1:181366429-181366451 TTTGACCTGAGGCACTTTGAGGG + Intergenic
922816640 1:228453852-228453874 GTTGCCCACAGCCACCAAGAGGG + Intergenic
923092459 1:230750790-230750812 CTTGCCCTGGGCTCCCTTGAGGG - Intronic
924902830 1:248419730-248419752 GTTGCTATGACCCGCCTTGAGGG - Intergenic
1063015256 10:2070615-2070637 GTGGCCCTGACCCAGCTTGCTGG - Intergenic
1063026550 10:2184506-2184528 GTTGTCCTCTGCCTCCTTGAGGG - Intergenic
1063548081 10:7001389-7001411 GGAGCCCTGAGCCACCGTGGAGG + Intergenic
1065804864 10:29384917-29384939 GTTGCAGTGAGCCAACTTGCAGG + Intergenic
1065944274 10:30592865-30592887 GTTGCAGTGAGCCAACTTGCAGG - Intergenic
1068618905 10:59155655-59155677 GTTGCAGTGAGCAACCCTGAAGG - Intergenic
1070788981 10:79178571-79178593 GTGGCCCTGAGACAGCTTTATGG + Intronic
1075426618 10:122346856-122346878 GTTGCAGTGAGCCAACTTGCAGG + Intergenic
1077962371 11:7089353-7089375 GGTGGCCTGGGCCACCTTGATGG - Exonic
1080225833 11:29959051-29959073 GTTTCCCAAAGTCACCTTGAGGG - Intergenic
1081785626 11:45744838-45744860 TTTTCCCTGAGGCATCTTGAAGG - Intergenic
1086330905 11:85753219-85753241 GCTGCCCTGACCCACCTTTAAGG - Intronic
1091786619 12:3246800-3246822 GTTCCTCTGAGCCACCTGGATGG - Intronic
1091993872 12:4977599-4977621 CTTGACCTCAGCCACCTTGTAGG - Intergenic
1094252598 12:28381822-28381844 ATTACCCTGAGCCACTTGGATGG + Intronic
1096241796 12:49963633-49963655 GTCACCCTGGGCCACCTTGTCGG + Exonic
1096617166 12:52839910-52839932 CTTGGCCTGAGCGTCCTTGAGGG + Exonic
1098271989 12:68778055-68778077 GCTGCAATGAGCCACCGTGATGG + Exonic
1098923950 12:76328576-76328598 TTTGCAGTGAGCAACCTTGAAGG + Intergenic
1099612255 12:84888924-84888946 GTTTCTATGACCCACCTTGAGGG - Intronic
1102233395 12:111278945-111278967 GGAGCCCTGAGCTACCTTGCTGG - Intronic
1102828362 12:115970628-115970650 GTTGGCTGGAGCCACCTGGATGG + Exonic
1103234827 12:119362820-119362842 ATAGGCCTGAGCCACCTTGTGGG - Intronic
1104272420 12:127294045-127294067 GAAGCCCTGAGCCTCCTTTATGG - Intergenic
1104611773 12:130234849-130234871 GTTGCCCTGAGTCCCCTTCTGGG - Intergenic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104714899 12:131010184-131010206 GCTGCCATGTGCCACCTTGTTGG + Intronic
1105585083 13:21736289-21736311 GCTGCACTGAGTGACCTTGATGG + Intergenic
1105993789 13:25650115-25650137 GAGGCCCTGGGCCAACTTGAGGG + Intronic
1111991347 13:95120502-95120524 GTTGCCATGAGCCAAGATGATGG + Intronic
1112992414 13:105530146-105530168 ATTGCAATGAGCCACTTTGAGGG + Intergenic
1118768845 14:68928389-68928411 GGTGCCCAGAGCCCCCTTCAAGG - Intronic
1119720769 14:76888642-76888664 TTTGCCCTGGGCCAGCCTGAAGG + Intergenic
1121101925 14:91255184-91255206 GGAGCACTGAGCCACCTAGAGGG - Intergenic
1125450167 15:39799643-39799665 GGTGCCTTGAGCAAGCTTGAAGG - Intronic
1125550059 15:40538419-40538441 GGTGCCCTGTGACCCCTTGAGGG - Intronic
1126475068 15:49056796-49056818 CTTTCCATGAGCCTCCTTGAAGG + Intergenic
1126979909 15:54228843-54228865 GTCTCCCTGAGCCACCTAGATGG + Intronic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1128783139 15:70376118-70376140 GCTGCCCTGAGCCATCCTCAGGG - Intergenic
1128899155 15:71403638-71403660 TTTGCAGTGAGCAACCTTGAGGG + Intronic
1131308814 15:91269273-91269295 CCTGCCCTGATCCATCTTGAGGG - Intronic
1131398838 15:92108630-92108652 CTTGCCCTGAGAGGCCTTGATGG + Intronic
1132648123 16:1008330-1008352 GTTGTCCTGAGCCTCCTAGTTGG - Intergenic
1134326227 16:13210332-13210354 GTTGCATTGAGCCATCTTAAGGG - Intronic
1136105008 16:28024176-28024198 GTTGCCCTCAGCCCCATTGAAGG - Intronic
1136186511 16:28591651-28591673 GTATCTCTGAGCCACATTGAGGG - Exonic
1138351723 16:56349508-56349530 CTTGCCCTGAGCCACCTCACTGG - Intronic
1139741196 16:69036644-69036666 GAATCCCTGTGCCACCTTGAAGG - Intronic
1139948981 16:70660178-70660200 CTTGCCCTGAGCACCCTGGATGG + Exonic
1143766149 17:9138852-9138874 GTGACCCTGAGCCACCTTGTGGG - Intronic
1146018003 17:29249154-29249176 GTTGGTCTGAGCCATCTTGGTGG - Exonic
1151890184 17:76947058-76947080 GTGGATCTGAGCCACCATGAGGG + Intronic
1153676093 18:7456907-7456929 GTTCCTCTGAGCATCCTTGAGGG + Intergenic
1154412450 18:14148728-14148750 AGTGCCCTGAGCCACCTGCACGG - Intergenic
1160317207 18:77859126-77859148 GCTCACCTGAGCCTCCTTGATGG - Intergenic
1160914483 19:1490209-1490231 GTTACCCTGGGACACCTGGACGG + Exonic
1161244885 19:3245484-3245506 GGTGCCCTGAGCAACATTTAAGG - Intronic
1168377122 19:55889689-55889711 TTTGCACTGAGCAAACTTGAGGG - Intergenic
925005435 2:439808-439830 GTTGAACTGAGCCACCTTGTGGG + Intergenic
925333334 2:3075374-3075396 GCTGACCTGAGTCACCTTTAGGG - Intergenic
926096739 2:10086208-10086230 GTTACCCTGGGCCACCATGTAGG + Intergenic
929481290 2:42310725-42310747 TTGGGCCTGAGCCACCATGATGG - Intronic
930250448 2:49028769-49028791 GGTGCCCAGAACAACCTTGAAGG + Intronic
932347379 2:71004515-71004537 GTGGCACTGAGCCATCTCGATGG + Intergenic
933048104 2:77564730-77564752 GTTACCCTGAACTGCCTTGATGG - Intronic
935189099 2:100761605-100761627 GCTACCCTGAGCAAACTTGAGGG + Intergenic
936095150 2:109525648-109525670 GTTGTCCTGAGCTACCCTGATGG - Intergenic
937131287 2:119515765-119515787 GTTGGCCTGAGCCATGTTGCTGG + Intronic
941192827 2:162407625-162407647 GTTGCCCTTAGAAACCTTAATGG - Intronic
944217916 2:197274301-197274323 GTTGCTCTGAGGCACAGTGAGGG + Intronic
945195922 2:207237703-207237725 CTTATCTTGAGCCACCTTGAGGG - Intergenic
948438444 2:237969367-237969389 GCTTCCCTGAGCCTCCTTCAGGG + Intronic
1168985153 20:2041692-2041714 GTTCCCCTGAGGCTCCTTGCAGG - Intergenic
1171201310 20:23244652-23244674 GGCGCCCTGGGCCACCTGGAGGG + Intergenic
1172747867 20:37226955-37226977 GTTGCCTTGAGGCAGCTTCAGGG + Intronic
1174411772 20:50341101-50341123 GAAACCCTGAGCCTCCTTGATGG - Intergenic
1175726911 20:61324776-61324798 GTTGCCCTAAGTCATCTTCAAGG + Intronic
1177201346 21:17960092-17960114 GTATCCCTGAGGCATCTTGAGGG - Intronic
1178877686 21:36425349-36425371 GTGGCCCTGGACCACCCTGAGGG + Intergenic
1182388395 22:29967714-29967736 GTTGCCAGGAGCCAGGTTGAGGG - Intronic
1185291999 22:50031902-50031924 GTGGTCCTGGGCCACCTTCATGG + Exonic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
953044448 3:39282113-39282135 TTTGCAGTGAGCAACCTTGAAGG - Intergenic
953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG + Intronic
953936261 3:47046003-47046025 ATTCACCTGAGCCACCCTGAGGG - Intronic
954321229 3:49833263-49833285 CCTGCCTTGAGCCACCTGGAGGG - Intronic
955088035 3:55721874-55721896 GTGGCCCAGAGCCACCTTTCTGG + Intronic
966099302 3:176246865-176246887 GTTGCCCTGAGGCATCTTAGAGG + Intergenic
966376248 3:179298539-179298561 GTTGCCATGAGTAACCTTGTGGG + Intergenic
966969630 3:185031555-185031577 GTTGCCTTTAGACACCTGGAGGG + Intronic
967071581 3:185967099-185967121 ATTGCCCAGAACCAACTTGAGGG + Intergenic
967224922 3:187282098-187282120 GTTACCCTGAAGCACCTTGAGGG - Intronic
968760757 4:2441935-2441957 GTGGCCCTGAGACACCTGTAGGG + Intronic
969707900 4:8821734-8821756 GTTGCTGTGGGGCACCTTGATGG - Intergenic
993661176 5:90636679-90636701 GGGGCCCTGAATCACCTTGAGGG - Intronic
996589289 5:125127837-125127859 TGTGACCTGAGCCACCCTGATGG - Intergenic
998213144 5:140216822-140216844 GTTGCCCTGACCCATCCTCAGGG + Intronic
998600756 5:143582344-143582366 GTTTCCCTCAGCCCCCCTGATGG - Intergenic
999857555 5:155611394-155611416 GTTGCCCTGAGCAACAATAAAGG - Intergenic
1000334360 5:160231114-160231136 GTTGCTCTGAGCCAGCTGGCAGG - Intronic
1001455107 5:171854325-171854347 TTTGCCCTTGGCCAGCTTGATGG + Intergenic
1002097297 5:176839114-176839136 GATGCCCTGTGCCACCTTCCAGG + Intronic
1003721862 6:8712019-8712041 AATGCCCTGAGCTGCCTTGAAGG - Intergenic
1006523136 6:34583633-34583655 GCTGCCCCGAGCCACGTTGTGGG - Intergenic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1007043235 6:38745057-38745079 TTTGCAGTGAGCAACCTTGAGGG + Intronic
1007642779 6:43355987-43356009 GTTGCCCTGAGGTTCCTTCAAGG + Exonic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1008774242 6:55016920-55016942 CTTGGCCTGAGCCAGCTGGAAGG - Intergenic
1012025311 6:93982525-93982547 GTTGCCCTGACCTACCTTAAGGG + Intergenic
1018568674 6:165184379-165184401 GTTGTCCTGAGCCTCCGCGATGG - Intergenic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1022612158 7:31886658-31886680 GTTGACCAGAGCCATTTTGAAGG + Intronic
1023912289 7:44564556-44564578 GTATCCCAGAGCCACCCTGATGG - Intergenic
1026357016 7:69566710-69566732 GTTTACCTGAGCCACACTGATGG - Intergenic
1029219596 7:98977686-98977708 GGTGGCCTGAGCCACACTGAAGG - Intronic
1029961738 7:104694911-104694933 GTTGCAGTGAGCTAACTTGAAGG + Intronic
1030117676 7:106074477-106074499 GTTTCCCTGAACCTCCTTGCAGG - Intergenic
1033390605 7:140924453-140924475 GATGCCCTCAGCCACCTTCTCGG - Intronic
1035616134 8:1003151-1003173 GTGGCCCTGCGCCATCCTGAAGG - Intergenic
1035751190 8:1997573-1997595 GCTGCCCAGAGCCTCCTAGAGGG + Intronic
1036384844 8:8270053-8270075 GGTGGCCTCAGACACCTTGAAGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1039966327 8:42286869-42286891 GGTGCCCTGTGCCACCCTGCAGG + Intronic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1040581171 8:48699709-48699731 GTTGACCTGAGACATCTGGAGGG - Intergenic
1040829368 8:51660723-51660745 GTCTCCCTGAGCTACCATGAAGG + Intronic
1044303454 8:90611037-90611059 CTTTCCCTGAGCTACCTTTAGGG + Intergenic
1047842960 8:128774098-128774120 GTTGGCCTGAGCTAACTTGAAGG + Intergenic
1048664396 8:136644384-136644406 GTTTCCCTGGGACACTTTGAGGG + Intergenic
1051158744 9:14181816-14181838 CTTGGCATTAGCCACCTTGAGGG - Intronic
1054983775 9:71237439-71237461 TTTCCCCTCAGCCACCTTGTAGG - Intronic
1058200921 9:102039390-102039412 GCTTCCCTGAGCCACATTGGAGG + Intergenic
1059405100 9:114094467-114094489 GAGGCCCAGAGCCACCTTTATGG + Intronic
1060492209 9:124093213-124093235 GGTGGCATGAGCAACCTTGATGG - Intergenic
1060780186 9:126406205-126406227 GAAGCCCTGAGGCTCCTTGAAGG - Intronic
1061231772 9:129319719-129319741 CTGGCCCTGAGCCACCCTGTGGG + Intergenic
1061543518 9:131290722-131290744 GCTGCCCAGAGGCAGCTTGAAGG + Intronic
1062200921 9:135302169-135302191 CTTGCCCTGAGCCCCCAGGAGGG - Intergenic
1188103624 X:26121659-26121681 TTTGACCAGAGCCACCTTCATGG + Intergenic
1188716884 X:33469558-33469580 GCTTCCCTGAGCCACATTGGAGG - Intergenic
1189327168 X:40119924-40119946 GTTGCTCTGAGCCAAGTTGGGGG + Intronic
1194110291 X:89825009-89825031 CTTGTCCTGGGCCACCATGAAGG + Intergenic
1195400773 X:104458795-104458817 GTTGCCTGGATCCACCTTGAGGG + Intergenic
1198571912 X:137966276-137966298 GATTCCCTGAGCCAACTTCAGGG + Intergenic