ID: 950868927

View in Genome Browser
Species Human (GRCh38)
Location 3:16212507-16212529
Sequence CTTTAAGAACGGCGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950868927_950868939 30 Left 950868927 3:16212507-16212529 CCTATTTCCCGCCGTTCTTAAAG 0: 1
1: 0
2: 0
3: 0
4: 70
Right 950868939 3:16212560-16212582 TCGTGGCAGGCCTGGCTCTGTGG 0: 1
1: 0
2: 5
3: 23
4: 324
950868927_950868934 13 Left 950868927 3:16212507-16212529 CCTATTTCCCGCCGTTCTTAAAG 0: 1
1: 0
2: 0
3: 0
4: 70
Right 950868934 3:16212543-16212565 GTGTTTATCTTTTCCCTTCGTGG 0: 1
1: 25
2: 62
3: 80
4: 262
950868927_950868933 -9 Left 950868927 3:16212507-16212529 CCTATTTCCCGCCGTTCTTAAAG 0: 1
1: 0
2: 0
3: 0
4: 70
Right 950868933 3:16212521-16212543 TTCTTAAAGGTGGAATGCTGAGG 0: 1
1: 0
2: 2
3: 14
4: 220
950868927_950868936 22 Left 950868927 3:16212507-16212529 CCTATTTCCCGCCGTTCTTAAAG 0: 1
1: 0
2: 0
3: 0
4: 70
Right 950868936 3:16212552-16212574 TTTTCCCTTCGTGGCAGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
950868927_950868935 17 Left 950868927 3:16212507-16212529 CCTATTTCCCGCCGTTCTTAAAG 0: 1
1: 0
2: 0
3: 0
4: 70
Right 950868935 3:16212547-16212569 TTATCTTTTCCCTTCGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950868927 Original CRISPR CTTTAAGAACGGCGGGAAAT AGG (reversed) Intronic
901363783 1:8727790-8727812 CTTTAAGAATAGTGGGTAATTGG - Intronic
901563466 1:10092060-10092082 ATTTAAGAAAGGAGAGAAATGGG + Intronic
901758477 1:11455645-11455667 CTTTTATAAAGGGGGGAAATTGG + Intergenic
904963858 1:34356402-34356424 CTTTAAGAATGGAGCAAAATGGG - Intergenic
905679833 1:39861623-39861645 CCTTAAGAAAGGCAGGAAGTTGG + Intronic
906939038 1:50239459-50239481 TTTTAAGAAGGGAGGGGAATGGG - Intergenic
913539876 1:119808593-119808615 ATTTAGGAACTGCAGGAAATAGG - Intronic
913684254 1:121216403-121216425 TGTTAAGAACTGCAGGAAATGGG + Intronic
914036094 1:144004018-144004040 TGTTAAGAACTGCAGGAAATGGG + Intergenic
914153365 1:145063927-145063949 TGTTAAGAACTGCAGGAAATGGG - Intronic
920471560 1:206234895-206234917 TGTTAAGAACTGCAGGAAATGGG + Intronic
1067550707 10:47233703-47233725 CTTTAACAACTGAGGGGAATTGG - Intergenic
1074757076 10:116632039-116632061 CTTGAAGAACTGCAGGACATAGG + Intronic
1075958058 10:126542148-126542170 TTTTAAGTACTGGGGGAAATAGG + Intronic
1076840868 10:133044574-133044596 GTGGAAGGACGGCGGGAAATGGG + Intergenic
1077563035 11:3277306-3277328 TTTTAGGAACAGGGGGAAATAGG - Intergenic
1077568926 11:3323122-3323144 TTTTAGGAACAGGGGGAAATAGG - Intergenic
1078996210 11:16702591-16702613 CTTCAAGAAGGTCTGGAAATGGG - Intronic
1080456408 11:32423507-32423529 CTTTCACAACTGTGGGAAATAGG + Intronic
1081595525 11:44456585-44456607 CTTTCAGAACTGGGAGAAATTGG + Intergenic
1084361761 11:68673279-68673301 CTTTATGAGCAGCGGGAAAATGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1101857450 12:108455795-108455817 CTTTAAGAGGGGCTGCAAATGGG - Intergenic
1105295375 13:19084766-19084788 CTTAAAGATCTGGGGGAAATGGG + Intergenic
1111073853 13:83206109-83206131 CTTTATAAACGACTGGAAATAGG - Intergenic
1120480905 14:85047852-85047874 CTTTATGAGCAGCGGGAAAATGG + Intergenic
1122892277 14:104738295-104738317 CATTAAGAACAGCATGAAATGGG - Intronic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1130440399 15:83947124-83947146 CTTTAAGAAGGGTGGCAATTTGG - Intronic
1133571154 16:7041629-7041651 TTTTAAGAAGGGTGGTAAATTGG - Intronic
1134140005 16:11710277-11710299 CCTTAAGAACAGCCTGAAATGGG - Intronic
1138990961 16:62390676-62390698 CTTTAACAACTGTGGAAAATTGG - Intergenic
1150742035 17:67786902-67786924 CTTTAAGAAAGGTGTGAAAACGG - Intergenic
1151233349 17:72700641-72700663 CTTTATGAACAGCGTGAAAACGG - Intronic
1160970920 19:1767443-1767465 CTTTTAGAAAGGCAGGAAGTGGG + Intronic
1162730458 19:12715425-12715447 CTTGAAGAACTGCAGGAACTTGG + Exonic
1162883177 19:13675656-13675678 CTTTAAGAAAGGAGCCAAATTGG - Intergenic
926889420 2:17626493-17626515 CTATGAGAATGGCAGGAAATGGG - Intronic
931994737 2:67829136-67829158 TTTTAAAAATGGCAGGAAATGGG + Intergenic
933128446 2:78641937-78641959 TTTTATGAAAGGCGGGAAAATGG - Intergenic
933381194 2:81548218-81548240 CTTTAAGAATGGTTGGAATTTGG - Intergenic
934054721 2:88242081-88242103 CTTGAAGGACTGTGGGAAATAGG - Intergenic
943894217 2:193332574-193332596 TTGTAAGAACTGCGGGAAAAAGG + Intergenic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
1170816545 20:19719424-19719446 CCTTAAGAAGGGTGGGAGATGGG + Intronic
1175481702 20:59315854-59315876 CTTCAAGAAAAGCTGGAAATCGG + Intronic
1177384329 21:20389267-20389289 CTTTTAAATAGGCGGGAAATAGG - Intergenic
1179632919 21:42689621-42689643 ATTTAAACTCGGCGGGAAATAGG + Intronic
1181866654 22:25863005-25863027 TTTGAAGAACGGAGAGAAATAGG - Intronic
950868927 3:16212507-16212529 CTTTAAGAACGGCGGGAAATAGG - Intronic
955063687 3:55516305-55516327 CTTTAAAAACGGGGTGGAATGGG + Intronic
956113283 3:65892820-65892842 CTTTAACAATGACAGGAAATAGG + Intronic
961582244 3:127892357-127892379 CCTTAGGTACGGAGGGAAATGGG - Intergenic
962244360 3:133779445-133779467 CTTTATCAACTGCAGGAAATGGG - Intergenic
965044435 3:163557483-163557505 CCTTAAGAAAAACGGGAAATTGG - Intergenic
965606101 3:170498974-170498996 CTTTAAGAAGGGCAGTAAACTGG + Intronic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
984595379 4:181661453-181661475 CTTTAAGAACTAGGGGAAACAGG - Intergenic
1004065527 6:12240232-12240254 CTTTAAGAAAGGCGCGCACTTGG + Intergenic
1026431665 7:70353606-70353628 CTTTATGAACAGTGGGTAATGGG - Intronic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1045716568 8:105053975-105053997 TTTTAAGAACAACGGAAAATGGG + Intronic
1047362832 8:124184678-124184700 TTTTAATAATGGTGGGAAATGGG + Intergenic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1051693525 9:19743384-19743406 CTTTAAGAATTGCAGAAAATTGG - Intronic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1187733446 X:22280015-22280037 CTCTAACTACGGGGGGAAATGGG - Intergenic
1190758435 X:53421006-53421028 CTTGAAGAACGGGGGCAAGTGGG + Intronic
1192693478 X:73390498-73390520 CATTAAGAATGGATGGAAATAGG + Intergenic
1195051171 X:101098261-101098283 TTTTAAGCACCGCGCGAAATGGG + Intronic