ID: 950869121

View in Genome Browser
Species Human (GRCh38)
Location 3:16213589-16213611
Sequence ATGCTGTTTAATGTGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950869114_950869121 2 Left 950869114 3:16213564-16213586 CCAGTCCTTCCAGATTGACCCAT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG 0: 1
1: 0
2: 2
3: 26
4: 249
950869113_950869121 3 Left 950869113 3:16213563-16213585 CCCAGTCCTTCCAGATTGACCCA 0: 1
1: 0
2: 0
3: 12
4: 174
Right 950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG 0: 1
1: 0
2: 2
3: 26
4: 249
950869115_950869121 -3 Left 950869115 3:16213569-16213591 CCTTCCAGATTGACCCATAAATG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG 0: 1
1: 0
2: 2
3: 26
4: 249
950869116_950869121 -7 Left 950869116 3:16213573-16213595 CCAGATTGACCCATAAATGCTGT 0: 1
1: 0
2: 1
3: 10
4: 82
Right 950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG 0: 1
1: 0
2: 2
3: 26
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950869121 Original CRISPR ATGCTGTTTAATGTGGGAAA TGG Intronic
900288436 1:1913337-1913359 ATGCTGTTTAATGGGGGCGGGGG + Intergenic
901089850 1:6634023-6634045 ATGTTGTTTAATGTAGAAAATGG + Intronic
901315399 1:8304091-8304113 ATGCTTTGTGATGTGGGAAATGG + Intergenic
901563831 1:10095575-10095597 ATGGTGTCTCATGTGAGAAAAGG + Exonic
904380226 1:30105702-30105724 AGGCTGTTTCATTTGGCAAAAGG - Intergenic
906278285 1:44534943-44534965 ATGCTATTTAGAGCGGGAAAGGG + Intronic
906367367 1:45222263-45222285 ATGCTATTTAATATTGGAGATGG - Intronic
906440593 1:45839864-45839886 AGGCAATTTAATGGGGGAAAAGG + Intronic
908399164 1:63754081-63754103 ATGCTACTTTATGTGGCAAAAGG + Intergenic
909338856 1:74509129-74509151 CTGCTATTTAATGAGGAAAAAGG - Intronic
910046068 1:82918600-82918622 ATGTTATTTAATGTGGGCAGTGG - Intergenic
910809812 1:91224666-91224688 ATGTTGATTAATGAGAGAAAAGG + Intergenic
910984337 1:92991019-92991041 ATGCAGATTTATGTGGTAAATGG + Intergenic
911931710 1:103912772-103912794 ATATTGTTCAATGTGGCAAAGGG + Intergenic
912588086 1:110785048-110785070 ATGCTGTTTAATGAAGGGAAGGG + Intergenic
912595667 1:110873276-110873298 TTGCTGTCTAATGTGGGGTAGGG + Intronic
912901085 1:113649613-113649635 ACTCTGTTTAATGAGGGCAAAGG - Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
915330061 1:155105842-155105864 ATGGTGTGTAAGGAGGGAAATGG + Intergenic
916726716 1:167530034-167530056 TTGCGGTTTTATGTGGCAAAGGG - Intronic
916837472 1:168562277-168562299 ATGCTATTAAAAGTGGGCAAAGG + Intergenic
917050304 1:170915094-170915116 ATTATGTTTTATGTGGGAGAGGG - Intergenic
917781831 1:178405403-178405425 ATGCTATCTTATGTGGCAAAAGG + Intronic
919143925 1:193609350-193609372 ATGGCCTTCAATGTGGGAAAAGG - Intergenic
919258570 1:195158398-195158420 ATGCTGTTTAATGTGATTAGCGG - Intergenic
919986085 1:202676214-202676236 ATGTGGTTGAATGTGGGAAGTGG - Intronic
920551382 1:206864254-206864276 ATACTGTCAAATGTAGGAAAAGG - Intergenic
920887875 1:209949960-209949982 ATGCTTTTAAAAGTGGGAATTGG + Intronic
922853133 1:228751258-228751280 AAGTGGATTAATGTGGGAAAGGG + Intergenic
923294652 1:232581808-232581830 ATGCTGTTTATTTTGGGTAAGGG - Intergenic
924415523 1:243851955-243851977 ATGCTGGGAAATATGGGAAAAGG - Intergenic
1063323791 10:5077065-5077087 ATCCTGTTTAACCAGGGAAATGG - Intronic
1065337818 10:24672476-24672498 ACGGTGTTTAATGTAGGAAATGG - Intronic
1072859752 10:98990945-98990967 ATGGGGTTTGATTTGGGAAATGG - Intronic
1073128052 10:101164557-101164579 ATGCTGATTAGTGAGGGAAGGGG + Intergenic
1073431077 10:103487687-103487709 ATGATGTTTAATGTGGAATGCGG + Intergenic
1076216866 10:128701881-128701903 CTGCTGTTTAATGAGTGAGAGGG + Intergenic
1076625760 10:131820821-131820843 ATGTTATTTTATGTGGCAAAGGG + Intergenic
1077311858 11:1892334-1892356 ATGCTGTGCAGTGTGGGAATGGG - Intergenic
1078882534 11:15466330-15466352 ATGTTACCTAATGTGGGAAAAGG - Intergenic
1079398641 11:20087314-20087336 ATGCTGTGGAATGTAAGAAAAGG - Intronic
1079584253 11:22106288-22106310 ATGCAGTCTAATGTGAAAAAAGG - Intergenic
1080543165 11:33288896-33288918 ATGCAGTTTATTGTTAGAAATGG + Intronic
1084710567 11:70841403-70841425 CTGCTGTGTAATGGGGAAAATGG - Intronic
1086382087 11:86265433-86265455 ATGCTATTTAATTTAGCAAAAGG - Intronic
1091027573 11:132155780-132155802 ATGATGGTTTATGTGTGAAAGGG - Intronic
1091722708 12:2824835-2824857 AAGCTGTTTTATGGGGGAATGGG - Exonic
1092666706 12:10808577-10808599 ATGATATATGATGTGGGAAAAGG - Intergenic
1094323644 12:29212691-29212713 ATGCCGTTTTATGGGGGAAAAGG - Intronic
1095152273 12:38809516-38809538 ATGTTGTGTTATGTGGCAAAAGG - Intronic
1095341568 12:41095446-41095468 ATGCCCTTGAATGTGGGGAAAGG - Intergenic
1096465661 12:51846918-51846940 ATGGTGTTAAACATGGGAAAGGG + Intergenic
1097156164 12:57013727-57013749 AGGCTGTTTCTTGTGGGAAAAGG - Intronic
1098572085 12:71999254-71999276 CTGCTATTTAATGTGGGCAATGG + Intronic
1099049520 12:77766486-77766508 TTGCTGTCTAATGTGGATAATGG + Intergenic
1103879998 12:124158749-124158771 ATGCTGGTTAGTGTGGGAGCTGG + Intronic
1104631925 12:130409994-130410016 ATGCTGGTGAAAGTGGAAAATGG - Intronic
1107125430 13:36840604-36840626 ATGTTGTCTTATGTGGCAAAAGG + Intergenic
1107174804 13:37387985-37388007 ATGCTGTTTGAAGTGGGAAAGGG - Intergenic
1107770430 13:43783681-43783703 ACGATGTTTAATGAGTGAAAAGG + Intronic
1108722044 13:53142099-53142121 ATGCTGTATAACTTGGGAGATGG - Intergenic
1109248876 13:59993641-59993663 AGGTTGTTTAAAGTGGGAATGGG + Intronic
1109359658 13:61279667-61279689 AGGCTGTTTAGTTTTGGAAAGGG - Intergenic
1109413979 13:62011384-62011406 ATGCTCTTTATTATTGGAAAAGG - Intergenic
1111379562 13:87429925-87429947 ATGCTGTTTATTTTTGGCAAAGG - Intergenic
1112186827 13:97135860-97135882 ATGCTGTTAAAAGTGGAAATGGG + Intergenic
1112525659 13:100144317-100144339 ATATTGGATAATGTGGGAAATGG + Intronic
1112638011 13:101239004-101239026 ATGTTTTTTAAGGAGGGAAATGG - Intronic
1114356459 14:21914733-21914755 AAACTGTGTAATTTGGGAAATGG + Intergenic
1116466897 14:45244448-45244470 AAGCTGATTAATGAGGGCAAAGG - Intronic
1117658628 14:57982094-57982116 ATGGTTTTTGATCTGGGAAAGGG - Intronic
1119927362 14:78507994-78508016 ATGCTTTTTGATGAGGGTAATGG + Intronic
1119957383 14:78813688-78813710 ATGTTGTTTGTTCTGGGAAATGG + Intronic
1120540610 14:85745900-85745922 ATGAAGTTTACTGGGGGAAAAGG + Intergenic
1121034025 14:90684022-90684044 ATGCTGTTTAAAATGGAAAATGG - Intronic
1121917210 14:97846269-97846291 ATGGTGATTAATGTGGTAGAAGG + Intergenic
1202888376 14_KI270722v1_random:130952-130974 ATACTGTTTATGGTGGGAGAAGG - Intergenic
1124611056 15:31208914-31208936 ATGCAGTTTCAAGTGAGAAAAGG + Intergenic
1126294121 15:47118282-47118304 ATGCTGATAAATCAGGGAAATGG - Intergenic
1127148975 15:56054451-56054473 ATCCTGTTAAACCTGGGAAATGG - Intergenic
1127613931 15:60664312-60664334 ATGGTTTTTGATGTTGGAAAAGG - Intronic
1128543937 15:68555040-68555062 ATGCTGGGCAGTGTGGGAAAGGG - Intergenic
1131605970 15:93902696-93902718 TGGCTTTATAATGTGGGAAAGGG - Intergenic
1131988211 15:98066195-98066217 ATGATTTTTAATGTGGCCAAGGG - Intergenic
1133139538 16:3734180-3734202 ATGCTGTCAATTCTGGGAAATGG - Intronic
1133691524 16:8220356-8220378 TTATTGTTTCATGTGGGAAAGGG - Intergenic
1133841862 16:9417196-9417218 AGCCTGTTAAATGTGGGAAGGGG + Intergenic
1134401944 16:13918396-13918418 AGGTTGTTTTATGTGGCAAAGGG - Intergenic
1134787110 16:16954539-16954561 ATGATTTTTAATAGGGGAAAAGG - Intergenic
1135887533 16:26324682-26324704 ATGCAGTAAGATGTGGGAAAAGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140848133 16:78909003-78909025 AGGTTGTTTATTTTGGGAAAGGG + Intronic
1141114960 16:81300528-81300550 ATGTTGCTTTATGTGGCAAAAGG - Intergenic
1141255696 16:82400528-82400550 ATGCTGTTTAATCTTTGACAAGG + Intergenic
1141810947 16:86375260-86375282 ATGCTGGCTCATGTGGGAGATGG + Intergenic
1142585925 17:973313-973335 CTGCTGTTTCGCGTGGGAAATGG - Intronic
1142906924 17:3049541-3049563 ATCCTGTTTACTGTGGGATGCGG - Intergenic
1143981298 17:10872533-10872555 TTGCTTTTTAATGAGGCAAAGGG + Intergenic
1146133824 17:30300801-30300823 AGGCAGTTTAATTTGGGGAAAGG + Intergenic
1146154367 17:30508372-30508394 ATGCTCTTTAATGTGCTAAGTGG + Intronic
1146332052 17:31936095-31936117 ATGCTGTTTAGAGTATGAAATGG + Intergenic
1149783901 17:59419756-59419778 ATGCTGTTTTTTTTGGGAACAGG + Intergenic
1150504991 17:65689786-65689808 ATTCAGGTTAATATGGGAAATGG + Intronic
1152478494 17:80534270-80534292 ATGCTGTTTAAAATGTCAAATGG + Intergenic
1153562895 18:6389138-6389160 CTTCTGTTTAATGAGGGTAAAGG - Intronic
1155418969 18:25633190-25633212 TTGTTTTTTAATGTGTGAAAAGG - Intergenic
1155825577 18:30438405-30438427 ATGATTTTAAATATGGGAAAAGG - Intergenic
1158057186 18:53295637-53295659 ATTCTGTTTAATGTTGGAAAGGG - Intronic
1159360377 18:67394046-67394068 TTACTGTTTAAAGTGGGATATGG - Intergenic
1162702542 19:12528477-12528499 ATGATGTCTAATGTGGAAAAGGG - Intronic
1167124578 19:47540326-47540348 TTGCTGGTTACTGTGGGACATGG + Exonic
1168076905 19:53985449-53985471 ATGCTGGGAAATGTAGGAAAAGG + Exonic
925691404 2:6527280-6527302 AAGCTTTTTAATGTGTGAATTGG - Intergenic
925761676 2:7190946-7190968 TTTTTGTTTAATGTGGGATAAGG - Intergenic
926227249 2:10976527-10976549 ATATTGATTAAAGTGGGAAAGGG + Intergenic
927523714 2:23719003-23719025 ATGTTGTTTTATGTGGTAAAGGG - Intergenic
929021294 2:37555945-37555967 ATGCTGTTTAAAGTAGAAATTGG + Intergenic
931236337 2:60415925-60415947 AAGCAGTTTAATGGGGGAAAGGG - Intergenic
931658129 2:64528826-64528848 AGGCTTTTTACTGTGGGAGATGG + Intronic
931691831 2:64840175-64840197 ATCCTCTTTACTGTGGGACAGGG - Intergenic
933106210 2:78328722-78328744 GTGTTGTTTGATGTGAGAAATGG + Intergenic
934013472 2:87852159-87852181 ATGCTTTTTAAAGTGTGAAAGGG + Intergenic
935376447 2:102403611-102403633 ATGGTGTTTAGTCTGAGAAATGG + Intergenic
936797311 2:116223306-116223328 ATTCTATTAAAAGTGGGAAAAGG + Intergenic
937115906 2:119404801-119404823 ATAATGTATAATGTAGGAAAGGG - Intergenic
937431881 2:121845750-121845772 ATGCTGTCTAATTTTGAAAATGG + Intergenic
938385841 2:130866459-130866481 ATGCTATGTTATGTGGCAAAGGG + Intronic
940450000 2:153825207-153825229 ATGCTGCTTAATGTTCTAAAAGG + Intergenic
941187331 2:162333190-162333212 ATTTTGTTGAAGGTGGGAAAGGG + Intronic
941592252 2:167434367-167434389 ATACTGTTTAAACTGGGGAATGG - Intergenic
941664311 2:168229007-168229029 ATGCTTTTAGATGTGGGAAGAGG - Intronic
942636301 2:178010331-178010353 ATGCTATTGAACGTGGGACAAGG + Intronic
942672884 2:178395256-178395278 TTGTTGTTAAATGTGTGAAATGG - Intronic
945520932 2:210826186-210826208 ATTCTGTTAAATGTCAGAAAAGG - Intergenic
947965213 2:234274615-234274637 GTGCTGATTATTTTGGGAAAAGG - Intergenic
948709464 2:239816900-239816922 AAGTTGTTTAATGTGGCAAATGG - Intergenic
1169030294 20:2401438-2401460 ATACTGTTTAAGCAGGGAAAAGG - Intronic
1169094950 20:2889085-2889107 AAGTTTTTTGATGTGGGAAAAGG + Intronic
1170010921 20:11723238-11723260 ATTCTTTTTAATGTGGCAACGGG + Intergenic
1170519064 20:17164457-17164479 CTGCTCATTAATATGGGAAATGG + Intergenic
1174843094 20:53918146-53918168 ATGCAGAGTAAGGTGGGAAATGG + Intergenic
1174953509 20:55068918-55068940 ATGGTGATTAATTTGTGAAATGG - Intergenic
1177653208 21:23984146-23984168 AAGTGGTTTAATGTGGAAAAAGG - Intergenic
1177663455 21:24119545-24119567 ATTTTGTTTAATGTGATAAAGGG - Intergenic
1179573807 21:42294398-42294420 ATGATGCTTAATGTGGCAGAAGG - Intronic
1180125962 21:45790509-45790531 ATGATGTTTTATGCCGGAAATGG + Intronic
1181173340 22:21022554-21022576 AGGTTGTTTAAGGTGGGAAGGGG + Intronic
1183641104 22:39093035-39093057 ATTCTGTTTCATTTGGGATAAGG + Intergenic
1183996616 22:41638417-41638439 ATACTGTTTACTGTAGGCAATGG + Intronic
949510242 3:4760928-4760950 ATGCTGTCTTATGTGGCGAAGGG - Intronic
950297755 3:11846708-11846730 AGGCGGTTTAGGGTGGGAAATGG + Exonic
950665787 3:14494079-14494101 CTGCTCTTTCATGTGAGAAAGGG - Intronic
950869121 3:16213589-16213611 ATGCTGTTTAATGTGGGAAATGG + Intronic
955111195 3:55951701-55951723 ATGCTGTGGTATGGGGGAAAGGG - Intronic
955537290 3:59937559-59937581 CTGTTGTTTACTGTGGGAATTGG + Intronic
955623729 3:60894092-60894114 ATGCTTTTTATTGTGGGGATGGG + Intronic
958463473 3:94428037-94428059 CTGCAGTTTAAATTGGGAAAGGG - Intergenic
958986915 3:100791271-100791293 ATTCTCTTTAAAGTAGGAAAAGG + Intronic
961897377 3:130179542-130179564 TTTCTGTTTACTGTGGGCAATGG + Intergenic
963950978 3:151200361-151200383 ACACTGTTTAATGTGCAAAAGGG - Intronic
965773782 3:172208325-172208347 ATGCTGTGTACTGTCAGAAATGG + Intronic
967449039 3:189601735-189601757 ATGCTACTGAATGTGGGAAATGG - Intergenic
968244614 3:197131290-197131312 ATAATGTTTAATGTTGGCAAAGG - Intronic
969914885 4:10481033-10481055 ATACAGTTGAAAGTGGGAAATGG - Intergenic
970089872 4:12393391-12393413 AAGCTGTTTGATTTGTGAAATGG + Intergenic
970206531 4:13660928-13660950 ATGCCATTTACTGTGGGAATGGG + Intergenic
970673709 4:18423931-18423953 AGGCTCTTTATTGTGGGGAAAGG + Intergenic
970745099 4:19284633-19284655 ATGCTGCCTTATTTGGGAAAGGG + Intergenic
970746864 4:19308988-19309010 ATGATGATAAATGTGAGAAACGG + Intergenic
971013881 4:22467500-22467522 ATGCTGTTTAAAATCTGAAAAGG - Intronic
971454907 4:26835054-26835076 ATGTTGTCTTATGTGGCAAAAGG + Intergenic
971964445 4:33534907-33534929 ATGCATTTTAATTTGGGAAAAGG - Intergenic
972378992 4:38501377-38501399 ATGGTGATCAATGTAGGAAAAGG - Intergenic
972723543 4:41725096-41725118 ATCCTGTTTAATGTATGTAAGGG - Intergenic
972817910 4:42665158-42665180 ATGATGTTTGATGTATGAAAAGG + Intergenic
975512590 4:75210257-75210279 TTGCTGTCTAATGGGGGATATGG + Intergenic
975861640 4:78683583-78683605 ATGCTATATAGTGTGGTAAAAGG + Intergenic
976498022 4:85753032-85753054 TTGATGTTTAATTTGGGAAAAGG + Intronic
977216079 4:94285182-94285204 ATGATGTGTGATGTGGGAGAAGG + Intronic
977523500 4:98116160-98116182 ATGCTTATTCATGTGGGGAAAGG + Intronic
978093402 4:104745618-104745640 CTGCTGTTTAATTTGGCAAGCGG + Intergenic
978356474 4:107880233-107880255 AGGATTTTTAATTTGGGAAATGG - Intronic
978907133 4:114019135-114019157 ATGATGTTGAATGTGGGATGTGG - Intergenic
979339022 4:119498620-119498642 ATGCTGATTAATGGGGAAAGCGG - Exonic
979685448 4:123506411-123506433 TTGATGTTTAATGTGAAAAAAGG - Intergenic
980312821 4:131156039-131156061 ATTCTGCTTATTGTTGGAAATGG - Intergenic
980674565 4:136059055-136059077 ATTCTCTTTAATGTGTGGAATGG - Intergenic
981298576 4:143161030-143161052 ATGCTGTTTATTGTGGGCCGTGG - Intergenic
981426151 4:144605393-144605415 ATTCTGTTTAATTGTGGAAAAGG - Intergenic
982982586 4:162158840-162158862 TTGCTTTTTCATCTGGGAAAAGG - Intronic
983335167 4:166382446-166382468 ATGGTGTTTAATGATGAAAAAGG + Intergenic
983927847 4:173420988-173421010 CTGCTGTTTTTTGTGGTAAAAGG - Intergenic
984142282 4:176018480-176018502 ATACTGTTTAATGAAGGAGAAGG - Intergenic
986569471 5:9150137-9150159 GTGGTCTTTAAAGTGGGAAAAGG - Intronic
987507583 5:18793382-18793404 TTTCTGTTTAATGAGGGAACTGG + Intergenic
987771355 5:22309850-22309872 AAGATGTTTAATTTGGGAAGGGG + Intronic
988774455 5:34464794-34464816 ATGTTTTTTAATGTGAGAAGTGG + Intergenic
990939870 5:61191120-61191142 TTGCTGTACAAAGTGGGAAAAGG - Intergenic
990951783 5:61305524-61305546 ATGAGGGTGAATGTGGGAAAGGG + Intergenic
991517808 5:67458430-67458452 ATACTATTTACTGTGGGTAATGG - Intergenic
991997300 5:72400654-72400676 ATGCAGTTTAGTTTGGGGAAGGG - Intergenic
992020246 5:72616272-72616294 ATGCAATTTAATGAGGAAAAAGG + Intergenic
992400653 5:76408282-76408304 AGGCAGTTTAATATGGGATATGG + Intronic
993057366 5:82997634-82997656 ATGCTGTTTTTAGTGAGAAAGGG + Intergenic
993174117 5:84460313-84460335 ATGCTGTGAAATCTGGGAATAGG + Intergenic
993815258 5:92536415-92536437 CTGCTGTTTAATGTCTGAAATGG - Intergenic
995170208 5:109101289-109101311 ATACTGTTTAATGTGGAGCAAGG + Intronic
995313815 5:110743414-110743436 TGAATGTTTAATGTGGGAAATGG - Intronic
996769870 5:127074253-127074275 TTTCTGTTTTATGTGGGAAGGGG + Intergenic
996771026 5:127085797-127085819 ATCCTGTTTAATGGAGGAAAGGG - Intergenic
998776600 5:145610191-145610213 AACCTCTTCAATGTGGGAAAGGG - Intronic
1001136283 5:169105204-169105226 ATACTGTTTAATGTGGGTGGGGG + Intronic
1001160441 5:169307940-169307962 ATTGTGTTTGAGGTGGGAAAGGG + Intergenic
1001756733 5:174176165-174176187 GGGCTGTTCCATGTGGGAAAAGG - Intronic
1002348065 5:178561772-178561794 ATACTGTTTAATGTTTGAACAGG - Intronic
1004180080 6:13373367-13373389 ATGGTGTTTAATGTGGAATCTGG + Intronic
1004609936 6:17230368-17230390 ATGCTGTTTAAGGTGGACTATGG + Intergenic
1006448802 6:34094162-34094184 AAGCTGTTTACTGTGTGAAAGGG + Intronic
1006765502 6:36501497-36501519 AATCTTTTTAATGTGGGTAATGG - Intronic
1007305331 6:40899450-40899472 GGGCTGTTTAATGAAGGAAATGG + Intergenic
1009996606 6:70902266-70902288 AGGCAGTTCAATGGGGGAAAAGG + Intronic
1010008490 6:71023235-71023257 ATGATTATTAATGTGGGATATGG - Intergenic
1011169938 6:84494165-84494187 ACACTGGTTATTGTGGGAAATGG + Intergenic
1012024392 6:93970240-93970262 ATCCTGTTTACTTTGGTAAATGG + Intergenic
1012802737 6:103853183-103853205 ATGCTGTTGAATATGGTACATGG - Intergenic
1013309266 6:108878601-108878623 ATGCTGGTTATGGTGGAAAAAGG + Intronic
1013414076 6:109909022-109909044 ATGCTGTGTAAAGGGGAAAAGGG + Intergenic
1013974883 6:116065532-116065554 AAGATGGTTAATGTAGGAAAAGG - Intergenic
1014578237 6:123100810-123100832 ATGCTTTTTAATGCAGAAAATGG - Intergenic
1015326360 6:131928367-131928389 ATTATATTTAATGTGGGATAGGG + Intergenic
1015428874 6:133106271-133106293 ATGGTGTTTGATGTTGGCAAAGG + Intergenic
1018629726 6:165811452-165811474 ATGCTGTTTATTCAGGGGAAAGG - Intronic
1021153037 7:17175535-17175557 ATACAGTTACATGTGGGAAAAGG + Intergenic
1021485114 7:21158900-21158922 ATGCTATTTACTATGGGACATGG - Intergenic
1022707521 7:32818252-32818274 ATTGTGTGTAATGTGAGAAATGG + Intergenic
1023851412 7:44152353-44152375 ATGCTGGTGAAGGTGGGAGAAGG - Exonic
1024815367 7:53262782-53262804 ATGCTGTTTATTGAGGCATACGG + Intergenic
1025319507 7:58079585-58079607 TTTCTGTTTAATGTAGAAAATGG + Intergenic
1028626177 7:92880356-92880378 AGGCTATCTAATGTGGGTAAAGG + Intergenic
1030229758 7:107195329-107195351 AAGCTGTTAAATGTGGCTAAAGG - Intronic
1031139614 7:117927400-117927422 ATGCTTTATAATCTGGGGAAAGG + Intergenic
1034177708 7:149113290-149113312 ATGATTTTTATTGTGGGTAATGG - Intronic
1034392436 7:150797238-150797260 ATGCTGCTATTTGTGGGAAAAGG - Intronic
1035737004 8:1896262-1896284 CTTCTGTTTTATGTTGGAAAAGG + Intronic
1037585656 8:20274324-20274346 ATGGTGTTGCATTTGGGAAAGGG - Intronic
1039398294 8:37246412-37246434 ATGCTGATGGATGTGGCAAAAGG - Intergenic
1039545691 8:38409556-38409578 CAGGTGTTAAATGTGGGAAAGGG + Intergenic
1039712476 8:40069970-40069992 AGGCTGGTGAATGGGGGAAATGG + Intergenic
1041654796 8:60337926-60337948 ATGCTGTTAAATGTTTGACATGG - Intergenic
1042750618 8:72153910-72153932 ATGCTATTTAAGGTGGGGAAAGG - Intergenic
1044097598 8:88087448-88087470 ATGCTGAGTAGGGTGGGAAAAGG + Intronic
1044571378 8:93722893-93722915 ATGGAATTTAAAGTGGGAAATGG - Intronic
1044708179 8:95028458-95028480 ATCATGTTTAATGTGGTGAAGGG + Intronic
1044752275 8:95427889-95427911 ATTCTGTTTAATGAGTGAAAAGG - Intergenic
1045890756 8:107154235-107154257 AGGCTGTGTATTGTGGGAAATGG - Intergenic
1046875156 8:119246745-119246767 AGGCTGGATAATTTGGGAAAAGG - Intergenic
1050105855 9:2166022-2166044 ATCCCTTTTAATGTAGGAAACGG - Intronic
1050676635 9:8063065-8063087 AGGCTCTCTAATGTGGGGAAAGG - Intergenic
1050948768 9:11561418-11561440 TTGTATTTTAATGTGGGAAATGG - Intergenic
1052032138 9:23640778-23640800 ATGCAGTTTCATGTGGTAACTGG - Intergenic
1052294751 9:26884458-26884480 ATGCTGTTTAATGTAGTACCTGG + Intronic
1052665160 9:31486904-31486926 AGGCTCCTTAATGTGGGTAAAGG + Intergenic
1053145531 9:35709516-35709538 ATACTTGATAATGTGGGAAAAGG + Intronic
1055998422 9:82188232-82188254 ATGCTGGATAATGTGTGAAGAGG - Intergenic
1057325922 9:94063141-94063163 ATGCTGTATCATGTGGGACAAGG + Intronic
1058670701 9:107358442-107358464 TTGGTGTTTAATGTAGGAATAGG + Intergenic
1061873936 9:133534741-133534763 ATGCTCTTTGAAGTGGGAGAGGG + Intronic
1062172054 9:135140306-135140328 TTGCTGTTTGATGGGGGACACGG + Intergenic
1186258435 X:7748454-7748476 ATGCTCATTAATATGTGAAAAGG - Intergenic
1186762288 X:12735619-12735641 TTTCTGTTTTATGAGGGAAACGG - Intergenic
1186972355 X:14861318-14861340 ATGATGTTTAATGTGGTAATAGG - Intronic
1187446509 X:19365517-19365539 AGGCTGATTAATGAGAGAAAAGG - Intronic
1187467325 X:19539065-19539087 ATTATTTTTAATGTTGGAAAGGG - Intronic
1188524486 X:31074380-31074402 ATGTAGTTTTTTGTGGGAAAGGG + Intergenic
1190411350 X:50140111-50140133 ATGCTGTTTGCTGAGGGAAGAGG - Intergenic
1193470174 X:81891250-81891272 TTGCTGTTCATTGTGGGGAATGG - Intergenic
1195463949 X:105158992-105159014 AGGCTGGTGACTGTGGGAAAGGG + Intronic
1199131000 X:144186310-144186332 ATGCTTTTTAAAGTGTGAAAGGG - Intergenic