ID: 950871088

View in Genome Browser
Species Human (GRCh38)
Location 3:16229780-16229802
Sequence CAATTAGGCAATAAGCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950871088_950871092 -1 Left 950871088 3:16229780-16229802 CCAGATGGCTTATTGCCTAATTG 0: 1
1: 0
2: 2
3: 9
4: 83
Right 950871092 3:16229802-16229824 GGGTGAACAAAGCAAGAATATGG 0: 1
1: 0
2: 1
3: 22
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950871088 Original CRISPR CAATTAGGCAATAAGCCATC TGG (reversed) Intronic
907605206 1:55809697-55809719 GAATTCAGCAATAAGCCATCAGG - Intergenic
910708114 1:90151253-90151275 CAAATAGCCAATAAGCAATTTGG - Intergenic
912204397 1:107494240-107494262 CAATTCAGCAATAATGCATCCGG + Intergenic
914687511 1:149994033-149994055 CAATTAGTACACAAGCCATCTGG + Intronic
923267632 1:232329875-232329897 CAATTTAGCAATAATACATCTGG + Intergenic
1063099855 10:2940674-2940696 CAGTAAGGAAAAAAGCCATCTGG + Intergenic
1064420041 10:15182934-15182956 CAATTATGCAAAAAGACATTTGG - Intergenic
1064886012 10:20113421-20113443 CCTTTATCCAATAAGCCATCAGG + Intronic
1070472327 10:76794811-76794833 AAATTTGGAAATAAGCAATCAGG - Intergenic
1071353633 10:84771182-84771204 CAATTAGATTGTAAGCCATCAGG + Intergenic
1072681856 10:97513257-97513279 CAAGTAGACCATAAGCCATCTGG - Intronic
1072725493 10:97810619-97810641 CAATTGGCCAATGAGTCATCAGG + Intergenic
1072935241 10:99705768-99705790 CAATCTGTTAATAAGCCATCTGG + Exonic
1074822044 10:117187014-117187036 TAATGAGGCAATCATCCATCTGG + Intergenic
1077969243 11:7170361-7170383 CATTTAGGCAATCTGCCATTAGG + Intergenic
1088045597 11:105447272-105447294 AAATTTTGCAGTAAGCCATCAGG - Intergenic
1093284484 12:17241485-17241507 CAAGTAGGAAATAAGCTATGAGG - Intergenic
1093362877 12:18253817-18253839 AAACTAGCCAATAACCCATCTGG + Intronic
1095760179 12:45823822-45823844 GAATTCAGCCATAAGCCATCCGG - Intronic
1100948798 12:99821785-99821807 CAGATAGCCAAGAAGCCATCAGG + Intronic
1102003975 12:109577013-109577035 CATTTAGGCATTAATCCTTCTGG + Intronic
1102023483 12:109699794-109699816 CAATTAGGCCAGAAGCCATCAGG - Intergenic
1103075207 12:117976432-117976454 CAATGAGGCAAAAAGCCAAAAGG - Intergenic
1105562754 13:21510294-21510316 CAAGTAGGCAATAAACAATAAGG + Intronic
1107361989 13:39628547-39628569 GAAGTAGACAATAAGCAATCTGG - Intergenic
1108107649 13:47029455-47029477 CAATCAGTCAATAAGACAACTGG - Intergenic
1109611008 13:64764477-64764499 AAATTAGGCAATAAACAAACTGG + Intergenic
1114756677 14:25267937-25267959 CACTTAGGCACTTAGTCATCAGG - Intergenic
1125194555 15:37031298-37031320 CATTTAAGAAAGAAGCCATCTGG + Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1134140719 16:11715909-11715931 TAATTAGAAACTAAGCCATCTGG - Intronic
1144818072 17:18050661-18050683 CAATTGGCCAATAAGTCAACAGG - Intronic
1146403210 17:32516618-32516640 AAATTTGGCAAGAAGCCATGTGG - Intronic
1153540190 18:6145869-6145891 CAAAGATGGAATAAGCCATCAGG + Intronic
1155439641 18:25848543-25848565 AAATGAGGCAATAAGCCATGTGG - Intergenic
1161509493 19:4662689-4662711 CAAGAAGGCTATGAGCCATCAGG + Intronic
925317748 2:2938610-2938632 CATTTAAGCAGCAAGCCATCAGG - Intergenic
926514174 2:13820527-13820549 TAGATAGGCAATAGGCCATCAGG - Intergenic
926799348 2:16645894-16645916 CAATTAGATAATAAATCATCTGG - Intronic
933149538 2:78897305-78897327 CAATTGGGCCATAATCCATTCGG + Intergenic
934749472 2:96783578-96783600 CAATTAGGAAATCAGGCATCAGG - Intronic
938623490 2:133082766-133082788 CAATTAAACAGTAGGCCATCGGG - Intronic
939925648 2:148171022-148171044 GAATTTTGCCATAAGCCATCAGG - Intronic
940314318 2:152311371-152311393 CAATTTGGCAAAATTCCATCTGG - Intergenic
942465079 2:176199105-176199127 CAATTAGATCATAAGCAATCAGG - Intergenic
947405016 2:229766420-229766442 CAAATCTGCAATAATCCATCAGG - Intronic
947948175 2:234124605-234124627 CAATTGGGCAAGAAGACACCAGG - Intergenic
1170384654 20:15803049-15803071 GAATTCAGCAATAAGCCATCTGG - Intronic
1172202019 20:33133352-33133374 GAATGAGGCCATAAGTCATCTGG - Intergenic
1179505963 21:41840646-41840668 AAATTAAGCAATAAGCCATCAGG + Intronic
1183253971 22:36748688-36748710 CAATGAGGCAATGAGCCAGGAGG + Intergenic
1183800775 22:40162429-40162451 CAATTAGGCACTAAACTTTCTGG + Intronic
949485482 3:4533759-4533781 CTATTAGAAAAGAAGCCATCAGG + Intronic
950871088 3:16229780-16229802 CAATTAGGCAATAAGCCATCTGG - Intronic
951272865 3:20648941-20648963 CAATGAACCAATAAGCAATCTGG - Intergenic
956766817 3:72491172-72491194 CCCTTAGGCAATAAGCCTGCTGG - Intergenic
958270124 3:91489359-91489381 CCATTAGTCAATAAGGCACCTGG - Intergenic
959899654 3:111646101-111646123 CATTTGGGCAAAAAGCTATCTGG - Intronic
960152922 3:114269594-114269616 CACCTAGGCAAAGAGCCATCAGG - Intergenic
963382711 3:144552256-144552278 CAATAAGGCTATAAGCATTCTGG - Intergenic
966648870 3:182276589-182276611 CAATGAAGCAATAATCCCTCTGG + Intergenic
977000110 4:91487552-91487574 AAATTAGGCAAATAACCATCTGG - Intronic
978436220 4:108687218-108687240 AAATGAGGGAATGAGCCATCTGG - Intergenic
981659706 4:147152010-147152032 CAGTTAGCCAATAAGGCAGCTGG - Intergenic
981822961 4:148907142-148907164 TAATTTGGCAATAAATCATCTGG + Intergenic
990417949 5:55604813-55604835 CTATTAGGCAAAAAGTCATCAGG + Intergenic
993353846 5:86881879-86881901 CAATGAAGCAATAAGCCCTGAGG - Intergenic
999983432 5:156979604-156979626 CAATTAGTCATTAATCCCTCTGG + Intergenic
1000110239 5:158101236-158101258 ATATTAGGCAATAAACGATCCGG + Intergenic
1008985035 6:57531979-57532001 CCATTAGTCAATAAGGCACCTGG + Intronic
1009173073 6:60424935-60424957 CCATTAGTCAATAAGGCAACTGG + Intergenic
1011092067 6:83614526-83614548 CATTTATGCTATAAGCCATGGGG + Intronic
1012013444 6:93823729-93823751 CAGCTAGGCAATATGGCATCAGG - Intergenic
1014291116 6:119559951-119559973 CATTTAGGCAAAAGGACATCAGG - Intergenic
1015640955 6:135331800-135331822 TAATAAGGCAATATGGCATCTGG + Intronic
1017062420 6:150496860-150496882 CATTCAGTCTATAAGCCATCTGG + Intergenic
1029335459 7:99895593-99895615 TAATTAGGCAATAAATCAGCAGG - Intronic
1037005416 8:13773401-13773423 CACTTAGATAATAACCCATCTGG - Intergenic
1037883921 8:22586397-22586419 CAATTAGGCACTAAGCAGTGTGG + Intronic
1040633494 8:49243883-49243905 AATTTAGGCATGAAGCCATCTGG - Intergenic
1047360896 8:124168364-124168386 GAATTAGGGAATAAGGCACCTGG - Intergenic
1047952437 8:129946201-129946223 CAATTGGGCAATAACAAATCAGG - Intronic
1048811464 8:138290629-138290651 CAATGAGAAAATAAACCATCAGG - Intronic
1056488011 9:87078234-87078256 CAATTAGGACACCAGCCATCAGG + Intergenic
1057500908 9:95596069-95596091 TTACTAGGCAATAGGCCATCAGG + Intergenic
1058857181 9:109074327-109074349 CAATTTGGAACTCAGCCATCAGG + Intronic
1188291555 X:28395212-28395234 GAAATAAGCAATAAGCCATCAGG - Intergenic
1192666386 X:73091956-73091978 CAATTAGGCTCTAAGCTATGAGG - Intergenic
1194261505 X:91701130-91701152 AAATGAGGCATTAAGCCATTGGG - Intergenic
1194324384 X:92494690-92494712 AAATAAGGCAATAAGGCATCAGG + Intronic
1196739146 X:119009088-119009110 CAATTAGACAATATGCAATTAGG - Intronic
1198192161 X:134318145-134318167 TAATCAGGCATGAAGCCATCCGG - Intergenic
1198403987 X:136294508-136294530 AAATGAGGGAATAAGCCATGGGG - Intergenic
1200580156 Y:4939937-4939959 AAATGAGGCATTAAGCCATTGGG - Intergenic
1200633129 Y:5613906-5613928 AAATAAGGCAATAAGGCATCAGG + Intronic