ID: 950871306

View in Genome Browser
Species Human (GRCh38)
Location 3:16231927-16231949
Sequence CTCTAGGCACAGATCAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950871300_950871306 5 Left 950871300 3:16231899-16231921 CCTCAAGAAGGCACTGCCGATCA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950871306 Original CRISPR CTCTAGGCACAGATCAAGGG TGG Intronic
900557304 1:3287051-3287073 CTCATGGGCCAGATCAAGGGTGG - Intronic
902050467 1:13560372-13560394 CTCTGTGCACAGACCAAGGAAGG + Intergenic
906360515 1:45153660-45153682 ATCTAGGCACTGATCAACAGTGG + Intronic
907399547 1:54216462-54216484 CTCCAGGCAGAGATCCCGGGTGG - Intronic
908323135 1:62997492-62997514 CTCTAGGCACAGGGCAAGAAGGG - Intergenic
913132227 1:115851183-115851205 CTCTAGGCACAAGGCAAAGGCGG - Intergenic
915474679 1:156146781-156146803 CTCTGGGCACAGCGCAAAGGGGG - Intergenic
917765432 1:178211499-178211521 CTGTAGAGGCAGATCAAGGGAGG - Intronic
918703216 1:187631390-187631412 CTCTGTGCACAGACCAAGGTAGG + Intergenic
920319607 1:205109021-205109043 CTCTAGGAACAGAGGAAGGCAGG + Intronic
922548712 1:226477963-226477985 GTCTGGGCACAGCTCAAGTGAGG - Intergenic
1063105132 10:2986051-2986073 CTGCAGGCACAGGGCAAGGGTGG + Intergenic
1063306864 10:4910488-4910510 CTCTTGGCACAGCTAAAGTGGGG + Intergenic
1065810504 10:29438618-29438640 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1067164855 10:43857193-43857215 CTCTTGGCAAAGCTGAAGGGAGG - Intergenic
1070587932 10:77780371-77780393 ATGTCGGCCCAGATCAAGGGTGG - Intergenic
1070821031 10:79354498-79354520 GTCTAGGCACAGCTCAAGTGAGG - Exonic
1071283805 10:84125952-84125974 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1072693237 10:97584961-97584983 CTTTAGCCAGAGACCAAGGGAGG + Intronic
1075637621 10:124040301-124040323 CACCAGGGACAGATCAGGGGAGG + Intronic
1075800638 10:125151702-125151724 CTCGAGGCTCAGAGCAGGGGCGG - Intronic
1077826020 11:5808894-5808916 CTCTGTGCACAGATCAAGGTAGG - Intronic
1087224751 11:95586127-95586149 CTCTAGACACAGAACAGGGTAGG + Intergenic
1088367391 11:109053995-109054017 CTATAGGCACAGACCCTGGGTGG + Intergenic
1088903369 11:114135559-114135581 CTCTAGACACTGAACAAGGTAGG + Intronic
1089433492 11:118441951-118441973 CTCTAGCCACAGGGTAAGGGAGG - Intronic
1093501022 12:19812325-19812347 CTCTGGGGAGAGATTAAGGGAGG - Intergenic
1095238250 12:39824862-39824884 CTTCAGGCAGAGATCAAGGAGGG + Intronic
1101972107 12:109322217-109322239 CTCCAGGCAAAGATTAATGGAGG - Intergenic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1102976828 12:117212784-117212806 TGTTAGGCTCAGATCAAGGGTGG - Exonic
1103403826 12:120660921-120660943 CTCAAGTCCCAGATCAGGGGAGG + Intronic
1104565290 12:129875652-129875674 TTCAAGTCACAGAACAAGGGAGG + Intronic
1105265505 13:18810732-18810754 CTCTGGGCACATATGCAGGGAGG - Intergenic
1106095688 13:26641091-26641113 CTCTAGGCATAGCTAAAGGTAGG - Intronic
1107285111 13:38781829-38781851 CTCTAGGCACAGGACAGGAGAGG + Intronic
1117179897 14:53181153-53181175 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1118408754 14:65453963-65453985 CTCTAGGCAGAAAGCCAGGGTGG + Intronic
1119492611 14:75049862-75049884 CTCTAGGCACAGCTCATGCTTGG + Intronic
1121261533 14:92569761-92569783 CCCTAGGCAGAGATCAGTGGGGG + Intronic
1121700195 14:95947069-95947091 CACTGAGCACAGAGCAAGGGAGG - Intergenic
1127453354 15:59137323-59137345 CTCCAGGCACAGACCAGGGGAGG - Exonic
1129790502 15:78337884-78337906 CTGCAGGCACAAAACAAGGGCGG - Intergenic
1132474923 16:130016-130038 TTTTAGGCACAGATGAAAGGTGG - Intronic
1132693111 16:1190498-1190520 CTCTAGGCAGAGCCCCAGGGGGG + Intronic
1135286364 16:21196873-21196895 CTCTAGGCTCAGTTGAATGGTGG + Intergenic
1139318995 16:66097709-66097731 CTCTGGGCTCACACCAAGGGTGG - Intergenic
1139403488 16:66699984-66700006 CACTAGGCACAGTTCAGGGAAGG + Intergenic
1139941432 16:70608580-70608602 GAGGAGGCACAGATCAAGGGTGG + Intronic
1141327225 16:83072674-83072696 CTCCATGCACAGATCAAGCTTGG - Intronic
1142889347 17:2932941-2932963 CTCCAGGCACAGGTCGAGGCTGG + Intronic
1147397312 17:40154339-40154361 CTTTGGGCAAAGATCAAGTGTGG - Intronic
1152163353 17:78683645-78683667 CTCTAGGCCCAGTTGAAGGTGGG - Intronic
1153927024 18:9843224-9843246 ATCAAAGCACAGATAAAGGGTGG - Intronic
1155280591 18:24235709-24235731 CTCTAGCAAGAGATCAAGGCTGG + Intronic
1158856286 18:61545681-61545703 TTCTAGGCAGAGATCAAAGCAGG + Intronic
1160837809 19:1132791-1132813 CGCCAGCCCCAGATCAAGGGAGG - Intronic
1162329984 19:10021857-10021879 GTCTAGGCACAGAGGAGGGGAGG - Exonic
1162625443 19:11881087-11881109 CTCTGTGCACAGACCAAGGTGGG + Intronic
1162930744 19:13956301-13956323 CTCTCGGCCCGGAGCAAGGGGGG - Intronic
1164694069 19:30230423-30230445 CTCCAGGCACAGAACAAGATGGG - Intronic
1166289468 19:41852996-41853018 TTCTAGGCAGAGATCAGAGGAGG + Intergenic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1168345732 19:55649387-55649409 CTCTAGGGACACAGCGAGGGTGG - Exonic
1202639684 1_KI270706v1_random:70339-70361 CTCTGGGCACACATGCAGGGAGG - Intergenic
927201033 2:20578208-20578230 CGCTAGGCACTGGTCAAGAGAGG - Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
933390247 2:81657869-81657891 CTCTGTGCACAGACCAAGGAAGG - Intergenic
934495158 2:94789760-94789782 CTCTGGGCACACATACAGGGAGG - Intergenic
936141528 2:109946210-109946232 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936178217 2:110244158-110244180 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936203166 2:110425273-110425295 GTCTAGGCAGAGATGAAGGATGG + Intronic
936268636 2:111031336-111031358 ATGCAGGCACAGATCAAGTGAGG - Intronic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
941232174 2:162924271-162924293 CTTTATGCTCAGATCAAGGCAGG - Intergenic
941376712 2:164740462-164740484 CTCCAGGCAGAGAGCAAGGTAGG - Intronic
942746792 2:179243504-179243526 ATCTAGGCACCCATCAATGGTGG + Intronic
943369688 2:187001916-187001938 ATGTCGGCCCAGATCAAGGGTGG - Intergenic
945719912 2:213407016-213407038 CTCTGTGCACAGACCAAGGAAGG + Intronic
947556769 2:231099919-231099941 CTCTGTGCACAGACCAAGGAAGG - Intronic
948603626 2:239121318-239121340 CCCTATGCACAGATGAATGGCGG + Intronic
1168823394 20:792513-792535 CTCTGCGCACAGAGCAAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1171222268 20:23409758-23409780 CTGTAGGCACGGATTATGGGTGG - Intronic
1171251662 20:23653553-23653575 CTCCAGTGTCAGATCAAGGGAGG + Intergenic
1172032688 20:31992934-31992956 CTCTATTCACAGCCCAAGGGAGG - Intronic
1173557147 20:43974197-43974219 CTCTAGGCTGAGATCAGGGAGGG + Intronic
1178836757 21:36104961-36104983 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1179388728 21:40967952-40967974 CTCGAGGCACACAGGAAGGGAGG + Intergenic
1180362259 22:11911531-11911553 CTCTGGGCACACATGCAGGGAGG + Intergenic
1180716162 22:17873787-17873809 CTCTCGGGACAGGTCAAGGCGGG - Intronic
1182711687 22:32327303-32327325 CACTGGGCACAGATCCAGGCTGG + Intergenic
949202622 3:1397107-1397129 CTCTAGGCATGGCTCATGGGAGG - Intronic
950831471 3:15879512-15879534 ATATTGGCCCAGATCAAGGGTGG + Intergenic
950846896 3:16023506-16023528 CTCTGTGCACAGACCAAGGAAGG - Intergenic
950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG + Intronic
952589525 3:34933592-34933614 GTCTATTCACAGATCATGGGTGG - Intergenic
953250150 3:41238427-41238449 TTCTAGGCTCAGATCTCGGGTGG + Intronic
954380019 3:50214379-50214401 CTGTAGGCACAGGTCAGGGTGGG - Intronic
954604412 3:51897649-51897671 CTCTGTGCACAGACCAAGGAAGG + Intronic
954795216 3:53157955-53157977 CTCTTGGCAGGGATCAAGTGAGG + Intronic
957794313 3:84983583-84983605 CTCCAGGCAGAAATAAAGGGAGG - Intronic
960720836 3:120623059-120623081 CTCTGTGCACAGACCAAGGAAGG - Intergenic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
965219658 3:165912444-165912466 CTCTTGACACAGAGCAAAGGGGG - Intergenic
1202738873 3_GL000221v1_random:37049-37071 CTCTGGGCACACATGCAGGGAGG + Intergenic
968545452 4:1195500-1195522 CTCCAGGCACAGCTCGAGGTTGG + Intronic
970093015 4:12430877-12430899 CTCTGTGCACAGACCAAGGAAGG - Intergenic
970914157 4:21312827-21312849 CTCCAGGGACAGATCAAAGATGG - Intronic
971158928 4:24113484-24113506 CTCTATGCACAGAGAAAGTGGGG - Intergenic
973369931 4:49236692-49236714 CTCTGGGCACACATGCAGGGAGG - Intergenic
973391100 4:49558720-49558742 CTCTGGGCACACATGCAGGGAGG + Intergenic
974113426 4:57551728-57551750 CTTTAGGCAGAGAGCAAGTGGGG - Intergenic
974993921 4:69129100-69129122 CCCTGGGCACATGTCAAGGGTGG - Intronic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
980067076 4:128201406-128201428 CTCTAAGCACATATCAATTGGGG - Intronic
981935527 4:150235303-150235325 TTCTTGTCACACATCAAGGGTGG + Intronic
984050661 4:174860998-174861020 ATCTAGGAAGAGATTAAGGGAGG + Intronic
1202767042 4_GL000008v2_random:156194-156216 CTCTGGGCACACATGCAGGGAGG - Intergenic
985691165 5:1313478-1313500 CTTTGGGCACAGACCCAGGGGGG - Intergenic
986908041 5:12519386-12519408 CTCTAGTCATAGCTAAAGGGGGG - Intergenic
987783861 5:22472986-22473008 TTCTAGGGACAGATCAAGTAGGG - Intronic
989615838 5:43335889-43335911 CTCTGTGCACAGACCAAGGAAGG - Intergenic
990256580 5:53976758-53976780 TTCTATACATAGATCAAGGGAGG + Intronic
996099928 5:119435780-119435802 CTCTGTGCACAGACCAAGGAAGG + Intergenic
998552897 5:143094272-143094294 CTCTGTGCACAGACCAAGGAAGG - Intronic
998939059 5:147260961-147260983 CTCTGCGCACAGACCAAGGAAGG - Intronic
999204851 5:149840578-149840600 CTCTCGGCACTGATCAAGTTGGG - Intronic
999809472 5:155114501-155114523 CTCTAGGCACAGTGCGAAGGAGG + Intergenic
1002432262 5:179210534-179210556 CTCTAGGCACTGGTCCTGGGTGG - Intronic
1005981557 6:30840719-30840741 CTCTCAGCAAAGAGCAAGGGGGG + Intergenic
1007302113 6:40875327-40875349 CTCTAGGCTCAGGTCAAGGCAGG + Intergenic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1009635438 6:66259372-66259394 CTCTGTGCACAGATCAAGAAAGG + Intergenic
1012437161 6:99226671-99226693 CTCTAGGCCCCCAGCAAGGGAGG + Intergenic
1012807056 6:103908186-103908208 CTCTAAGCAAACATCAGGGGTGG - Intergenic
1014110559 6:117616080-117616102 CTCCATGCACAGACCAAGGAAGG + Intergenic
1014852992 6:126364092-126364114 CTCTAGGCTTAGTTCTAGGGTGG + Intergenic
1017753002 6:157506037-157506059 CTCTAGGCACTGATCATCCGTGG + Intronic
1018137032 6:160788923-160788945 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1018191715 6:161314886-161314908 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1022256274 7:28661458-28661480 CTCTATGTACATGTCAAGGGGGG + Intronic
1023165463 7:37338974-37338996 CTCCAGGCACTGATGGAGGGTGG + Intronic
1023436732 7:40147593-40147615 CTCTGTGCACAGACCAAGGAAGG - Intronic
1023798578 7:43813949-43813971 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1027475134 7:78620931-78620953 ATCCAAGCACAGATCAGGGGAGG + Intronic
1028199518 7:87944774-87944796 CCTAAGACACAGATCAAGGGTGG - Intronic
1028333503 7:89624846-89624868 CTCTGCGCACAGACCAAGGAAGG + Intergenic
1028793416 7:94878423-94878445 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1031120677 7:117718172-117718194 CTCAAGGCACAGCTAAATGGTGG + Intronic
1031372419 7:120984420-120984442 GTTTAGGTACAGATCAAGGAGGG - Intergenic
1033097222 7:138442182-138442204 ATGTTGGCCCAGATCAAGGGTGG + Intergenic
1033307967 7:140238884-140238906 CTCTGGGGACAGAACAAGGACGG - Intergenic
1035157722 7:156927928-156927950 CTCCAGGCACAGATCAGGCATGG - Intergenic
1035353905 7:158265767-158265789 GTCCAGGCACACATCAAAGGCGG + Intronic
1036105155 8:5830296-5830318 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1038522887 8:28248440-28248462 CTCTAGGAAAAGCTCCAGGGGGG - Intergenic
1040621212 8:49095258-49095280 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1042593754 8:70423798-70423820 CACTTGGCACAGATCTGGGGTGG - Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1046547528 8:115669534-115669556 TTCTTGCCACAGATAAAGGGCGG - Intronic
1047443385 8:124899167-124899189 CTCTCTGCACAGACCAAGGAAGG + Intergenic
1049248401 8:141575184-141575206 GTCTGGGCACAGACCATGGGAGG + Intergenic
1049290668 8:141799989-141800011 CTCTAGGGCCAGAGCCAGGGAGG + Intergenic
1049389945 8:142362579-142362601 CACTAGGCCGAGATCAAGTGGGG + Intronic
1049461715 8:142732638-142732660 CTCTGTGCACAGACCAAGGAAGG - Intronic
1053912415 9:42920760-42920782 CTCTGGGCACACATACAGGGAGG + Intergenic
1056415010 9:86367284-86367306 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1056586830 9:87932653-87932675 CTCTGGGCACACATGCAGGGAGG - Intergenic
1056610047 9:88120288-88120310 CTCTGGGCACACATGCAGGGAGG + Intergenic
1057162307 9:92897042-92897064 CTCTGGGCACACATGCAGGGAGG - Intergenic
1057919731 9:99087376-99087398 TGCAAGGCACAGAGCAAGGGGGG - Intergenic
1203707604 Un_KI270742v1:67493-67515 CTCTGGGCACACATGCAGGGAGG + Intergenic
1203547791 Un_KI270743v1:141071-141093 CTCTGGGCACACATGCAGGGAGG - Intergenic
1186217234 X:7313095-7313117 CTGTAGGCAGAGAAAAAGGGAGG - Intronic
1186449381 X:9659296-9659318 CTCTAGGGACAGAGCAGTGGTGG - Intronic
1186953742 X:14657083-14657105 CGCTAGACAAAGAGCAAGGGTGG + Intronic
1189034150 X:37479030-37479052 CTCTGTGCACAGACCAAGGAAGG + Intronic
1191890251 X:65932222-65932244 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1199637266 X:149825746-149825768 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1199637770 X:149829861-149829883 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1201900272 Y:19041390-19041412 CTCTGTGCACAGACCAAGGAAGG - Intergenic