ID: 950871855

View in Genome Browser
Species Human (GRCh38)
Location 3:16236251-16236273
Sequence TGTTAGACTATGAACTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950871852_950871855 13 Left 950871852 3:16236215-16236237 CCACCAAAGAGTGCCAATCAGGA No data
Right 950871855 3:16236251-16236273 TGTTAGACTATGAACTAGAGTGG No data
950871850_950871855 20 Left 950871850 3:16236208-16236230 CCACATACCACCAAAGAGTGCCA No data
Right 950871855 3:16236251-16236273 TGTTAGACTATGAACTAGAGTGG No data
950871854_950871855 0 Left 950871854 3:16236228-16236250 CCAATCAGGATATTTCAAAATTA No data
Right 950871855 3:16236251-16236273 TGTTAGACTATGAACTAGAGTGG No data
950871853_950871855 10 Left 950871853 3:16236218-16236240 CCAAAGAGTGCCAATCAGGATAT No data
Right 950871855 3:16236251-16236273 TGTTAGACTATGAACTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950871855 Original CRISPR TGTTAGACTATGAACTAGAG TGG Intergenic
No off target data available for this crispr