ID: 950873911

View in Genome Browser
Species Human (GRCh38)
Location 3:16253046-16253068
Sequence TCTTCCATGGAGGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950873911_950873921 26 Left 950873911 3:16253046-16253068 CCCTCCACCACCTCCATGGAAGA No data
Right 950873921 3:16253095-16253117 GCTCAGCCATGTGATCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950873911 Original CRISPR TCTTCCATGGAGGTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr