ID: 950874647

View in Genome Browser
Species Human (GRCh38)
Location 3:16260259-16260281
Sequence GACTGGCTTGGTATAGAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950874643_950874647 1 Left 950874643 3:16260235-16260257 CCATTCTAATGGGAAAACTGAGG 0: 1
1: 1
2: 4
3: 61
4: 510
Right 950874647 3:16260259-16260281 GACTGGCTTGGTATAGAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950874647 Original CRISPR GACTGGCTTGGTATAGAAAC TGG Exonic
902191251 1:14764756-14764778 ACCAGGCTGGGTATAGAAACAGG + Intronic
902307045 1:15549331-15549353 TACAGGCTGGGGATAGAAACTGG + Intronic
902334566 1:15747567-15747589 GGCTGGCTTGGTGTTGACACTGG - Exonic
905188643 1:36215558-36215580 TGCTGACTTGGTATAGAATCCGG - Intergenic
910687188 1:89929359-89929381 GAATGGCTTGTTAGAGAAACTGG + Intronic
919645588 1:200091428-200091450 GACAGGTCTGGTACAGAAACAGG - Intronic
1064073191 10:12247661-12247683 GAGTGGCTGGGTGAAGAAACCGG - Intronic
1065838764 10:29682670-29682692 GACAGGCTTGGTGAAGAAAGAGG + Intronic
1067786738 10:49255611-49255633 CACAGGCTTGGTATAGGATCTGG - Intergenic
1074012010 10:109491697-109491719 GACTGGCTTTGTAGGGAAAGGGG + Intergenic
1077006551 11:360600-360622 GACTGGCTCAGAATGGAAACTGG - Intergenic
1080084502 11:28262000-28262022 GACTGCCTTGGTTTAGATTCTGG - Intronic
1081581868 11:44357893-44357915 GACTCACTTGGTATGGAATCTGG + Intergenic
1081687029 11:45049903-45049925 GGATGGCTTGGCATAGAAGCTGG + Intergenic
1082018959 11:47515024-47515046 TACTGCCATGGTAAAGAAACAGG - Intronic
1082247617 11:49942683-49942705 GACTGGCCTGGTACTGAAGCAGG - Intergenic
1086244614 11:84737329-84737351 TATTGCCTTGGTATAAAAACAGG - Intronic
1088091325 11:106043434-106043456 GTCTGCCTTGGTAAAGAAATTGG - Intergenic
1090979345 11:131703917-131703939 GGCTGGCTTGGTATGGAAGTGGG - Intronic
1091683534 12:2544252-2544274 GACTGGCTAGTGATAGAAAAGGG - Intronic
1095967418 12:47878373-47878395 GAGTGTGTTGGTAAAGAAACTGG + Intronic
1098545073 12:71702773-71702795 GACTAACTTGGTCTAGAAAGGGG - Exonic
1099976339 12:89549465-89549487 TCATGGCTTGGCATAGAAACTGG - Intergenic
1103970031 12:124664757-124664779 AACTGGCTTGATATAGAGACAGG - Intergenic
1104677711 12:130725361-130725383 TACTGTTTTGGTATAAAAACAGG + Intergenic
1104856135 12:131903313-131903335 GACTGGCTTGGCATTGGCACTGG + Intronic
1107556982 13:41524917-41524939 TACTGGAGTGGTATAGAAAGTGG + Intergenic
1107805072 13:44146130-44146152 GAATGGGTTGGTATAAAACCAGG - Intronic
1115604212 14:34983952-34983974 GGCTAGATTGGAATAGAAACTGG - Intronic
1116351333 14:43867582-43867604 CCCTGGCTCTGTATAGAAACTGG - Intergenic
1122251189 14:100441081-100441103 GTCTGGTTTGGTCTTGAAACTGG + Intronic
1126499746 15:49332330-49332352 GACTGGCAAGGTAGAGACACAGG + Intronic
1130902666 15:88218882-88218904 TACTGGCTGGGTTTACAAACAGG - Intronic
1135635123 16:24069183-24069205 GACTAATTTGGTATAGAAAGTGG + Intronic
1144188767 17:12823859-12823881 GAGTGGTTTGGTAGAGCAACAGG - Intronic
1149032371 17:52098716-52098738 GACTGGCCCGGTAGAGGAACAGG - Intronic
1149208582 17:54277719-54277741 GAATGGTATGGTATAGAAATAGG + Intergenic
1156857186 18:41795491-41795513 GACTGGCTTCTTAGAGACACTGG + Intergenic
1160156613 18:76439109-76439131 GGCTAGCTTGGAAAAGAAACTGG - Intronic
1160300120 18:77670892-77670914 GACTGGCATGGAACAGAGACTGG + Intergenic
1160300152 18:77671062-77671084 GACTGGCGTGGGGTAGAGACTGG + Intergenic
931091371 2:58890310-58890332 TCCTGGCTTGGGAGAGAAACTGG - Intergenic
931670818 2:64645160-64645182 GACTGGCTTGATCTAGTGACTGG - Intronic
931843991 2:66183875-66183897 GCCTGGCTGGGTATGGAAACAGG + Intergenic
933608845 2:84413274-84413296 GACTGGCTTGTGAGAGAAATGGG + Intergenic
934896344 2:98123365-98123387 TGTGGGCTTGGTATAGAAACGGG - Intronic
940043515 2:149385610-149385632 GACTGACTTTGTATAGATACTGG + Intronic
942612410 2:177755792-177755814 GACTGGCTTGCTCTACAAAGGGG - Intronic
946834551 2:223760087-223760109 GTCTTGCATGGTATAGAACCTGG - Intronic
946973026 2:225116753-225116775 GACTGGCATGGTACAGAAGGGGG - Intergenic
1170091394 20:12593018-12593040 TACTAGCTTGGTACAGAAGCAGG - Intergenic
1170793214 20:19525116-19525138 GGCTGGCTTGGGAGAGAAAGGGG - Intronic
1171298112 20:24036454-24036476 GACTAGCTTGGGATAAAAATAGG + Intergenic
1171357526 20:24560739-24560761 TACTAGCCAGGTATAGAAACAGG - Intronic
1176156004 20:63620987-63621009 GAAAATCTTGGTATAGAAACAGG + Intronic
1177334844 21:19709669-19709691 GACTGGTTTATTATAGAAAAAGG + Intergenic
1177552493 21:22643743-22643765 TACTGGCTTGTTAGAGAAATGGG + Intergenic
1178673184 21:34610146-34610168 GACTGGCTTGGAAGAGGAACAGG + Intronic
949802189 3:7915828-7915850 AACTGGCTTGGTATAGAATTGGG - Intergenic
950874647 3:16260259-16260281 GACTGGCTTGGTATAGAAACTGG + Exonic
953058822 3:39409827-39409849 GACTGGCTTTTTTAAGAAACAGG - Intronic
954274292 3:49532389-49532411 GATTGCCTTGGTAAAGAAACTGG + Exonic
959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG + Intronic
963956290 3:151258064-151258086 GATTGGAATGGTATAGATACTGG - Intronic
964591596 3:158368403-158368425 GACTGGCTTTGTATAAATCCTGG + Intronic
971739167 4:30498817-30498839 GACTGGCTTGAAAGAGAAACAGG - Intergenic
973741936 4:53926703-53926725 GACTGACTTGGATTAGAATCTGG - Intronic
977789471 4:101082182-101082204 GACTGGTTGGGTATATAAACAGG + Intronic
978310547 4:107381308-107381330 GAGTGGCCTGGAACAGAAACCGG - Intergenic
979860216 4:125683766-125683788 GATAGGCTGGGTCTAGAAACAGG - Intergenic
981498963 4:145426162-145426184 GACTGTGGTGGTATAGAAACAGG - Intergenic
981647358 4:147015440-147015462 GACTGACTTGGCTTTGAAACAGG - Intergenic
982043817 4:151421748-151421770 AACTAGCTAGGTCTAGAAACAGG - Intronic
992996080 5:82334960-82334982 GACTGGCTTTGGATGGAATCAGG - Intronic
993165148 5:84343778-84343800 CCCTGGCTTGGAATAGAACCTGG + Intronic
994919324 5:106022501-106022523 GACTGGATTGGAAGAGAAATAGG - Intergenic
996441825 5:123499829-123499851 GACTGGCTTGGTAAAGTTACTGG - Intergenic
997398314 5:133582065-133582087 GACTTGCTGGGAAGAGAAACTGG - Intronic
998114701 5:139527243-139527265 AACTGTCTATGTATAGAAACTGG - Intronic
999205004 5:149841510-149841532 GACAGGCTTGCTCTGGAAACAGG - Intronic
1000121781 5:158204515-158204537 TACTGGATTGGCATAGGAACTGG - Intergenic
1001815635 5:174667034-174667056 GACTGCCATGGTATAAAAAAAGG + Intergenic
1003394814 6:5744049-5744071 GACAGGATTGGTTTAGGAACAGG + Intronic
1005787415 6:29260066-29260088 AACTGGCTTAATATGGAAACTGG + Intergenic
1009711193 6:67323559-67323581 AAATGGCTGGGTATAAAAACAGG + Intergenic
1012905654 6:105061951-105061973 GGCTGGCTTGGAAAAGAAAATGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020818010 7:12929831-12929853 AGCTGGCTTTGGATAGAAACAGG + Intergenic
1021925058 7:25526197-25526219 GGCTGGCTGGGTGTAGAAGCAGG + Intergenic
1021971292 7:25968089-25968111 GACTGGCTGGGTTTGGGAACTGG + Intergenic
1028614270 7:92747635-92747657 GACTGGCTTCCTAAAGAAAGTGG - Intronic
1032863610 7:135904531-135904553 GCCTGGCTTGGTTCACAAACAGG + Intergenic
1033663881 7:143423137-143423159 GAGTAGCTTTCTATAGAAACAGG - Intergenic
1033872087 7:145766652-145766674 GACTGGCATGTTTTAGAAACTGG - Intergenic
1036261932 8:7248056-7248078 GGCTGCCTTGGTACAGAAAACGG - Intergenic
1036304660 8:7591496-7591518 GGCTGCCTTGGTACAGAAAACGG + Intergenic
1036313972 8:7706601-7706623 GGCTGCCTTGGTACAGAAAACGG - Intergenic
1036355509 8:8039488-8039510 GGCTGCCTTGGTACAGAAAACGG + Intergenic
1041031339 8:53738513-53738535 GATTGGCTTTGTAGACAAACAGG - Intronic
1042048678 8:64683814-64683836 GACTGGCAAGGTGTAGGAACAGG - Intronic
1043469385 8:80547366-80547388 GAGTGGCTTGTTATCGAAAGAGG - Intergenic
1046897985 8:119493891-119493913 GAATGGCTTGGTTTTGAAATTGG - Intergenic
1048206276 8:132417791-132417813 GACTGGCTTGGCATATATTCCGG - Intronic
1051173250 9:14340845-14340867 TACTGACTTAGTATAAAAACTGG + Intronic
1056513309 9:87326808-87326830 GACTGGCTGGGTATGGTAGCTGG + Intergenic
1059739452 9:117135520-117135542 AACTGGCTTGGGATAGTAATTGG - Intronic
1061425418 9:130495274-130495296 GTCTGGCTGGGTATAATAACTGG + Intronic
1061517640 9:131098668-131098690 GACTAGCTTGGCTTAGAAAGAGG + Intronic
1061854498 9:133434142-133434164 GACTGGCCTGGTTTATGAACTGG - Intronic
1187027302 X:15448902-15448924 GTCTAGCTTGGGAGAGAAACCGG - Intronic
1188398489 X:29715877-29715899 GGGTTGCTTGGTAAAGAAACTGG - Intronic
1190400496 X:50029034-50029056 GAATCGCTTGGTATCGAAATGGG - Intronic
1191662856 X:63668721-63668743 GACAGGATAGGTATGGAAACTGG - Intronic
1194248901 X:91548647-91548669 GAATGGCTTGCTATATAATCAGG + Intergenic
1196468983 X:116003961-116003983 GATTGGCTTTGTGAAGAAACTGG + Intergenic
1197527952 X:127585353-127585375 GACTTCCTTGGTTTAAAAACAGG - Intergenic
1197938361 X:131763420-131763442 TAGTGTCTTGGTATAGAACCTGG - Intergenic