ID: 950874647

View in Genome Browser
Species Human (GRCh38)
Location 3:16260259-16260281
Sequence GACTGGCTTGGTATAGAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950874643_950874647 1 Left 950874643 3:16260235-16260257 CCATTCTAATGGGAAAACTGAGG 0: 1
1: 1
2: 4
3: 61
4: 510
Right 950874647 3:16260259-16260281 GACTGGCTTGGTATAGAAACTGG 0: 1
1: 0
2: 0
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950874647 Original CRISPR GACTGGCTTGGTATAGAAAC TGG Exonic