ID: 950874923

View in Genome Browser
Species Human (GRCh38)
Location 3:16263176-16263198
Sequence CAGTGTGACCAGAGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 436}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950874923_950874927 7 Left 950874923 3:16263176-16263198 CCTGCTCTGCTCTGGTCACACTG 0: 1
1: 0
2: 5
3: 53
4: 436
Right 950874927 3:16263206-16263228 TTTTGTTCCTTGATAAAATCAGG 0: 1
1: 0
2: 0
3: 50
4: 511
950874923_950874929 24 Left 950874923 3:16263176-16263198 CCTGCTCTGCTCTGGTCACACTG 0: 1
1: 0
2: 5
3: 53
4: 436
Right 950874929 3:16263223-16263245 ATCAGGCATGTTCCTGTCTTAGG 0: 1
1: 0
2: 6
3: 34
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950874923 Original CRISPR CAGTGTGACCAGAGCAGAGC AGG (reversed) Intronic
901153161 1:7117846-7117868 CAGGATGACCACAGCAGAACGGG - Intronic
901196062 1:7440344-7440366 CAATGTCCCCAGGGCAGAGCTGG + Intronic
901674466 1:10874903-10874925 CACTGTCATCAGAGCAGAACCGG - Intergenic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902238677 1:15074073-15074095 CTGTGTGACCACAGCCAAGCTGG + Intronic
902759457 1:18571735-18571757 CACTGTGACCAGAGGTGGGCTGG - Intergenic
902786252 1:18734463-18734485 CAGTCAGTTCAGAGCAGAGCAGG - Intronic
903575484 1:24337218-24337240 CACTGTCCCCAGAGCATAGCAGG + Intronic
903603639 1:24559438-24559460 CAGTGAGTCCTGAGCAGGGCAGG + Intronic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
904396643 1:30226962-30226984 CAGAGAGGGCAGAGCAGAGCAGG + Intergenic
904466896 1:30713657-30713679 CAGGTTGGCCAGAGCAGGGCAGG + Intronic
904813592 1:33180133-33180155 CAGAGTGACCTGAGCATAGTTGG - Intronic
905133227 1:35777415-35777437 CAGTATGAACAGAGCAGATGGGG + Intergenic
905408817 1:37754300-37754322 CACCGTGCCCAGAGCACAGCCGG - Exonic
906029233 1:42704401-42704423 CAGTGTGAGCACAGGAGAGCAGG + Intergenic
906152013 1:43592899-43592921 TAGTGTGACCAGCACAGAGTGGG - Intronic
906944097 1:50280929-50280951 CAATGTGCCCAGAGCAGACCTGG + Intergenic
907572622 1:55497975-55497997 CAGGGTGACCAGTGAAGGGCTGG - Intergenic
908511513 1:64853338-64853360 CAGTGTGACCTGGGCAGGGTGGG + Intronic
909237133 1:73166992-73167014 CAGTGCGGCTAGAACAGAGCAGG - Intergenic
909340024 1:74521017-74521039 CAGGGCAACCAGAGCAGAGAAGG - Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
911203884 1:95073598-95073620 CAGTGTGACCAGAGTAGTTGAGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912233088 1:107818105-107818127 CAGAGTGAGGAGAGCAGGGCAGG + Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917796654 1:178537814-178537836 CACTGTGAGCAGTGCTGAGCTGG - Intronic
919346761 1:196391041-196391063 CAGTGAGACTAGAGCATAACTGG + Intronic
919442151 1:197649175-197649197 CAATGTGACCAGAATAGAGGAGG + Intronic
920430997 1:205919055-205919077 TAGTGAGACCAGAGCAGGGATGG + Intronic
921949723 1:220916865-220916887 CAGTGAGTAAAGAGCAGAGCTGG + Intergenic
922534594 1:226370560-226370582 CAGTGTGATCGCAGGAGAGCTGG + Intronic
923235997 1:232033514-232033536 CACTGTGAACACAGCACAGCTGG + Intronic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
924624389 1:245687396-245687418 TGCTGAGACCAGAGCAGAGCAGG + Exonic
1063002325 10:1936119-1936141 GAGCGTGACCAGTGCTGAGCAGG + Intergenic
1063014132 10:2057853-2057875 GGGTGTCAGCAGAGCAGAGCTGG + Intergenic
1063159173 10:3407373-3407395 CAGTGTGCTCAGAACAGAGATGG - Intergenic
1063362391 10:5469090-5469112 CAGTGTGACCAACACTGAGCTGG - Intergenic
1063862587 10:10327764-10327786 CAGTGGGGACATAGCAGAGCTGG - Intergenic
1064367057 10:14717638-14717660 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1066243119 10:33556852-33556874 CAGGGTGAGCGGAGGAGAGCTGG + Intergenic
1067026161 10:42845913-42845935 AAGGGTGACCTCAGCAGAGCAGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068280704 10:54865212-54865234 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1068461676 10:57337185-57337207 GAGCGTGGCCAGAGCAGAGGTGG + Intergenic
1068663535 10:59648209-59648231 CAGGGTCATCAGAGCAGAGAGGG - Intergenic
1068957409 10:62830734-62830756 CAGTGTATGCAGAGCAAAGCTGG - Intronic
1069704668 10:70450946-70450968 CTATGTGACCTGAGCAGGGCTGG + Intergenic
1069817273 10:71206401-71206423 CAGTGTGGCCAAAACAAAGCAGG + Intergenic
1070678976 10:78435448-78435470 CAGTGTTCCCTGAGCAGAGGAGG + Intergenic
1070748544 10:78950052-78950074 TCCTGTGACCAGAGCAGAGAAGG + Intergenic
1070832226 10:79425065-79425087 CAGTCTGTCCAGGACAGAGCAGG - Intronic
1071673613 10:87634893-87634915 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1073558840 10:104480203-104480225 CATTGTCACCAATGCAGAGCTGG - Intergenic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074290818 10:112136977-112136999 AAATGGGATCAGAGCAGAGCTGG - Intergenic
1075044177 10:119133140-119133162 CAGTTTGGCAAGGGCAGAGCAGG - Intronic
1075283322 10:121160385-121160407 CAGTTTGGCCAGAGCTCAGCAGG - Intergenic
1075718681 10:124572229-124572251 CAGTGGGATGAGGGCAGAGCAGG + Intronic
1076467082 10:130690350-130690372 CAGAGTGAGGAGAGCAAAGCCGG - Intergenic
1076528135 10:131125695-131125717 CCACGTGAGCAGAGCAGAGCTGG - Intronic
1076795292 10:132795240-132795262 CAGTGTCTCCAGGGCAGGGCTGG + Intergenic
1076837925 10:133030384-133030406 CGGTGGGACCAGGCCAGAGCCGG - Intergenic
1077522217 11:3043157-3043179 CAGTGTGCTCAGAGCAGCCCAGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078358133 11:10647989-10648011 CAGCCTGACCAGGACAGAGCTGG + Intronic
1078579382 11:12526829-12526851 CAGAGGGACAAGAGCAGAGAGGG + Intronic
1079008600 11:16810331-16810353 GAGTCTGAGCAGGGCAGAGCAGG + Intronic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1080119854 11:28664640-28664662 CAGTGAGTCCAAGGCAGAGCTGG + Intergenic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081840791 11:46200108-46200130 CCGAGTGACCAGCACAGAGCAGG + Intergenic
1083213754 11:61205693-61205715 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083216639 11:61224522-61224544 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083219521 11:61243348-61243370 CAGTGTGGCGGGAACAGAGCCGG + Intronic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1084032218 11:66487714-66487736 CACAGTGTCCTGAGCAGAGCAGG + Intronic
1084707602 11:70824362-70824384 CAGAGGAACCAGATCAGAGCAGG - Intronic
1085107489 11:73857907-73857929 CAGGGTGCCTAGAACAGAGCAGG + Intronic
1085532639 11:77201052-77201074 CCGTGTGACCAGAGCACAGGGGG + Intronic
1085810809 11:79679383-79679405 TAGTGCAACCAGTGCAGAGCAGG - Intergenic
1086661572 11:89426288-89426310 CAGTGTGAGCAACGCAGAGAAGG + Intronic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087511301 11:99098358-99098380 CAGTGTAATCAGAGCAGTACAGG + Intronic
1087696913 11:101389781-101389803 CAGTATGACCAAAGCACAGAAGG - Intergenic
1088076106 11:105850559-105850581 TAGTGTGTCCTGAGCAGTGCCGG + Intronic
1088146407 11:106685678-106685700 CAGTATGAGCAGAGCAGACTGGG - Intronic
1088443167 11:109894556-109894578 CAGCATAACAAGAGCAGAGCAGG - Intergenic
1088890765 11:114042419-114042441 CAGTCTGTCCAGAGCTGAGGAGG + Intergenic
1089491483 11:118886859-118886881 CAGTGTGACCAGAGCATCACAGG + Intronic
1089785111 11:120902137-120902159 AAGTGTGCCCTGACCAGAGCGGG - Intronic
1090350610 11:126105534-126105556 CAGTGTGCTTGGAGCAGAGCAGG - Intergenic
1090751777 11:129752562-129752584 CAGAGTGTGCAGAGCACAGCTGG + Intergenic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1094145329 12:27222491-27222513 CAGGCTGAACTGAGCAGAGCTGG - Intergenic
1094472071 12:30812147-30812169 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1096239366 12:49951365-49951387 CAATGATACCAGAGCAAAGCAGG + Intronic
1096586656 12:52627074-52627096 TACTGTGAACAGAGCAGTGCTGG - Intergenic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099583449 12:84483844-84483866 CAGTGTGACTAGAATAAAGCAGG + Intergenic
1099957369 12:89363801-89363823 ATGTGTGACCAGTGCAGTGCAGG + Intergenic
1102573080 12:113839405-113839427 GAGTGTGTCCAGCACAGAGCAGG - Intronic
1102948376 12:117010507-117010529 CAGTGTGAGCAGCGCAGTGGGGG - Intronic
1103441667 12:120967609-120967631 CTGTGTGCCCAGCCCAGAGCTGG + Intergenic
1104004081 12:124880028-124880050 CAGTGGGCCCTGGGCAGAGCGGG - Intronic
1104431254 12:128718243-128718265 CAGTATGACCAGAACAAGGCAGG + Intergenic
1104747678 12:131220262-131220284 AAGTGTGGCCAGTTCAGAGCAGG + Intergenic
1104882752 12:132084036-132084058 CAGTGTGACCAGCGCTCAGCAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1107460654 13:40598693-40598715 CACTGGGAGTAGAGCAGAGCTGG - Intronic
1108116791 13:47137617-47137639 CAGTGTCTGAAGAGCAGAGCAGG - Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1110506059 13:76287679-76287701 CAGAGAGACCAGAACAGAGGTGG + Intergenic
1110585379 13:77184808-77184830 CATAGTGACCAGGGGAGAGCAGG - Intronic
1111958073 13:94780055-94780077 AAGTTTCAGCAGAGCAGAGCTGG - Intergenic
1111973806 13:94944935-94944957 CAGGGAGACCACAGAAGAGCTGG - Intergenic
1113189020 13:107722459-107722481 CAAGGTGGCCAGAGCAGTGCAGG - Intronic
1113439283 13:110315112-110315134 CAGGGTGTGCAGAGCAGAACTGG - Intronic
1113900270 13:113793092-113793114 CAGGCAGAGCAGAGCAGAGCTGG - Intronic
1118252089 14:64171677-64171699 CAGTGTGACTGGCGCAGAGCTGG + Intronic
1118922304 14:70160602-70160624 CAATGTGAGCAGACCAGGGCAGG + Intronic
1119004676 14:70912797-70912819 CAGTGTGACTACAGCACAGTGGG - Intronic
1119499281 14:75109709-75109731 CACTGTGACCACAGCAAAGTGGG + Exonic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1120251873 14:82068544-82068566 CAGTGTATCCAATGCAGAGCAGG - Intergenic
1120573286 14:86148554-86148576 CAGTGTGACCCAAGCAGATGTGG - Intergenic
1121120392 14:91372415-91372437 CACTGGGAGCAGAGGAGAGCGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121456083 14:94039673-94039695 CAGTGGGAGCAGGGCAGAGCAGG + Intronic
1122471749 14:101972537-101972559 CAGTATTCCCAGGGCAGAGCTGG + Intronic
1124857225 15:33400975-33400997 CAGGGTGACCAGACCATAGTGGG - Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1125452810 15:39826538-39826560 CAAGGTGACCATTGCAGAGCTGG + Intronic
1125515025 15:40313915-40313937 CAGTGTTACCAGAGCTTTGCAGG - Intergenic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1127656722 15:61062425-61062447 GAGAATGAGCAGAGCAGAGCCGG + Intronic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1128073811 15:64813700-64813722 CAGTGTGACCTGCTCACAGCTGG + Intergenic
1128894825 15:71363209-71363231 TTGTGTGACCACAGCAGAGTTGG - Intronic
1129719591 15:77870876-77870898 AAGTGTGCCCACAGCAGAGGCGG + Intergenic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130551128 15:84890521-84890543 CAGGCTCACCAGTGCAGAGCAGG - Exonic
1130959489 15:88650287-88650309 CTGTGTGACCAGAGCAGGGCAGG + Intronic
1131164340 15:90131431-90131453 CATTTTGCCCAGAACAGAGCAGG + Intergenic
1131956327 15:97740127-97740149 CAGTGTGACCAGAGCAGCCATGG + Intergenic
1132636438 16:952128-952150 CAGTGTCACCAGGGCAGGGCAGG - Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1134046887 16:11107708-11107730 CAGTGTAAGCCCAGCAGAGCTGG - Intronic
1136103479 16:28012091-28012113 ATCTGAGACCAGAGCAGAGCTGG - Intronic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137944198 16:52718024-52718046 CACTGAGACCAGAGCAGGGCAGG + Intergenic
1137952580 16:52797751-52797773 CATGGTGTCCAGAACAGAGCAGG - Intergenic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1139467895 16:67164027-67164049 CAGTGTGTCCAGGACCGAGCGGG - Exonic
1139546179 16:67650745-67650767 CAGTGTGACCAGGAGAGACCTGG - Intronic
1140902364 16:79381050-79381072 CAGGGAGGCCAGAGCAGAGGTGG - Intergenic
1141641639 16:85344929-85344951 CGGTGAGGGCAGAGCAGAGCTGG - Intergenic
1141849641 16:86636584-86636606 CAGTGTTTTCAGAGAAGAGCAGG - Intergenic
1141948133 16:87324175-87324197 CAGTGGGGCCAGAGCAGTCCCGG - Intronic
1142007105 16:87694555-87694577 CTGTGTGTCAAGAGCAGAGCCGG + Intronic
1142110556 16:88328869-88328891 CAGTTTGGCCACAGCAGAGGAGG + Intergenic
1142111075 16:88331989-88332011 CACTGTGCCAAGAGCAGAGCTGG + Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1144005383 17:11094892-11094914 CAGTGGGAGCAGAGCAGGGGAGG - Intergenic
1144331018 17:14224309-14224331 CAGAGTGCCCAGACCTGAGCAGG - Intergenic
1144493912 17:15735469-15735491 CCCTGTGACCAGGGCACAGCGGG - Intronic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144906349 17:18641210-18641232 CCCTGTGACCAGGGCACAGCGGG + Intronic
1145888095 17:28396558-28396580 CAGTGTCTCCAGAACTGAGCAGG - Exonic
1146376759 17:32299722-32299744 CAGTGACACCAGTGCAGAGTGGG + Intronic
1146648860 17:34593896-34593918 CAGCGTGACCGGAGACGAGCAGG - Intronic
1147182584 17:38695953-38695975 AAGTGAGACTAGAGCAGGGCTGG + Intergenic
1147745191 17:42690596-42690618 CAGAGTGCCCAGGGCAGAGGTGG + Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149955819 17:61048497-61048519 CAGTAAGACCAAAGAAGAGCGGG + Intronic
1152375215 17:79915395-79915417 CACAGTGGACAGAGCAGAGCTGG + Intergenic
1152484873 17:80583932-80583954 GAGGGTGACCACTGCAGAGCTGG - Intronic
1152930739 17:83108223-83108245 CTGGCTGACCAGAGCAGAGAAGG + Intergenic
1153294728 18:3534569-3534591 CAGTGTGACGACAGCAGTACAGG - Exonic
1154346221 18:13545761-13545783 CACTGTGACCTGTGCACAGCAGG - Intronic
1154415725 18:14174301-14174323 GGGTGGGACCAGAGCAGGGCAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155920949 18:31602244-31602266 TAGTGTGATCATAGCAGAGAGGG - Intergenic
1156990211 18:43400066-43400088 CAGGGTGACCTCAGCAGAGGAGG - Intergenic
1157004692 18:43568118-43568140 CACTGTCACAAGAGCAGTGCAGG + Intergenic
1157188786 18:45562866-45562888 CAGAGGGACCAGAGCAGAGCAGG - Intronic
1157581597 18:48777093-48777115 CGGGTTGACCAGTGCAGAGCAGG + Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157859885 18:51132104-51132126 AAATGGGACAAGAGCAGAGCAGG - Intergenic
1160013698 18:75125428-75125450 CAGAATGACCAAAGCAGGGCGGG - Intergenic
1160059990 18:75521081-75521103 AAGTGTGTCCAGGGTAGAGCAGG + Intergenic
1160177607 18:76608654-76608676 CTGTCTGAACAGAGCAGAGGTGG - Intergenic
1160261586 18:77299271-77299293 CAGTGTGAGCAGGGCAGAGCAGG - Intergenic
1161055364 19:2188297-2188319 CAGGGTGGCCAGGGCAGGGCAGG + Intronic
1161486239 19:4537342-4537364 CAGTGTGGCCAGGGCTCAGCTGG + Exonic
1161694489 19:5758419-5758441 CGGTGGGACTAGAACAGAGCAGG + Intronic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1164414945 19:28039247-28039269 CAGTGTGACCAGAGACCATCAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164803338 19:31096203-31096225 CTGTGTGACCGGGGCAGGGCTGG + Intergenic
1166053075 19:40272442-40272464 CAGTGTCAGCACAGCAGGGCTGG - Intronic
1167211777 19:48138022-48138044 GAGTGTGGACAGAGCAGAGAAGG + Intronic
1167288013 19:48609799-48609821 CAGTGTGCTCAGAGAACAGCTGG - Intronic
1167513148 19:49907427-49907449 CAGTGTGAATAGAACAGAGCGGG - Intronic
1167675804 19:50884523-50884545 TAGGGTGACCAGAGCAGTCCAGG + Intergenic
1167882119 19:52468729-52468751 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
925173485 2:1766992-1767014 CAGAGTGTCCAGAGCTCAGCAGG - Intergenic
925387641 2:3473220-3473242 CGGCGTGAGCACAGCAGAGCCGG - Intronic
925461376 2:4066148-4066170 CAGTGTGATCTGAGCTGAGTTGG + Intergenic
925844170 2:8020591-8020613 CTGTGGGACCAGAGGAGAACTGG + Intergenic
927045632 2:19275392-19275414 CAGTGAGGAGAGAGCAGAGCTGG - Intergenic
927683663 2:25156255-25156277 CTGTGTGCCCACAGCAGAGATGG - Exonic
927819025 2:26245782-26245804 GAAGGTGACCAGAGCACAGCAGG - Intronic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
928240498 2:29581540-29581562 CAGGGAGAGGAGAGCAGAGCTGG - Intronic
928333824 2:30378307-30378329 GAGGGTGGCCAGACCAGAGCTGG - Intergenic
929124508 2:38511029-38511051 CACTGTCCCCAGAGCAGAGCAGG + Intergenic
929349265 2:40928990-40929012 CAGTGTGGTCAGAGCAGAAATGG + Intergenic
929961085 2:46496798-46496820 CAGTGTGACAGGAGGAGGGCAGG + Intronic
930613911 2:53573699-53573721 CAGTTTGCCCAGGGCTGAGCAGG - Intronic
931121056 2:59220230-59220252 CAGTGTGCACAGAGCACAGCCGG + Intergenic
931960549 2:67477757-67477779 CCATGTGACCAGATGAGAGCAGG - Intergenic
932079149 2:68695530-68695552 CAGTGTGAGCAGGTAAGAGCAGG - Intronic
932709487 2:74051644-74051666 CAGGGTGCCTAGACCAGAGCAGG - Intronic
934660512 2:96141067-96141089 CAGTGTGAACTGGGCAGAGCCGG - Intergenic
935504132 2:103878690-103878712 CAGCGAGACCAGAGCTGAGGTGG + Intergenic
936432292 2:112475014-112475036 GAATGTGGCTAGAGCAGAGCTGG - Intergenic
937217682 2:120323097-120323119 AAGTGTGCACAGGGCAGAGCTGG - Intergenic
937321881 2:120965887-120965909 CAGAGGGGCCAGGGCAGAGCAGG - Intronic
937578461 2:123454295-123454317 CAGAATCACCATAGCAGAGCTGG + Intergenic
937983526 2:127628441-127628463 CAGTGTGGCCATCGCTGAGCTGG + Exonic
940427385 2:153545761-153545783 TAGTGTGGCCAGACCAGAGTTGG - Intergenic
940711424 2:157167049-157167071 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
942367546 2:175243615-175243637 CAGTGTGACTGAGGCAGAGCAGG - Intergenic
946409029 2:219507357-219507379 CAGCGGGAACCGAGCAGAGCGGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
948981637 2:241497707-241497729 CAGGGTGAGCAGGGCAGTGCAGG + Intronic
1169094791 20:2887768-2887790 CACTGTTACCAGAGCAGTGTGGG + Intronic
1170574628 20:17653061-17653083 AAGTGTGCCCGGAGCAGAGAAGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170732088 20:18984580-18984602 CAGGCTGAACAGAGCTGAGCTGG + Intergenic
1171445587 20:25201581-25201603 AAGAGTGACCAAAGGAGAGCAGG - Intronic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1172762844 20:37334055-37334077 CAGAGGGACCAGCCCAGAGCGGG + Intergenic
1172868315 20:38117787-38117809 CAATGTGACCAGCACACAGCTGG - Intronic
1173617981 20:44415262-44415284 CACAGTGGCCAGACCAGAGCTGG + Intronic
1173916300 20:46710710-46710732 CAGGATGGCCAGAGCACAGCGGG + Intronic
1174103322 20:48143990-48144012 CCATGTCTCCAGAGCAGAGCAGG + Intergenic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174283563 20:49456419-49456441 CAGTGAGTCCACGGCAGAGCTGG - Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1175457862 20:59128675-59128697 CAGTGTGACCAGGTCAGAGGTGG + Intergenic
1175682573 20:61001369-61001391 TAGTGTGACCATGGCAGAGAAGG + Intergenic
1175748986 20:61482088-61482110 CAATGGGCCCAGAGCAAAGCGGG - Intronic
1176148745 20:63577983-63578005 CACTGTGGCCTGAGCACAGCTGG - Intergenic
1176857616 21:13985003-13985025 GGGTGGGACCAGAGCAGAGCAGG - Intergenic
1176866992 21:14059224-14059246 GGGTGGGACCAGAGCAGAGCAGG + Intergenic
1178624647 21:34204640-34204662 CAGTGTTGCCAGCGCACAGCAGG + Intergenic
1178753316 21:35324528-35324550 CAGTGTAAGCAGAGCAGGCCTGG - Intronic
1179500055 21:41802990-41803012 GAGTGTGTCCAGGGCAGTGCTGG - Intronic
1179560904 21:42215574-42215596 CAGTGTGATCAGGACAGAACAGG - Intronic
1179721474 21:43318689-43318711 CAGTGTGTCCAGTGAAAAGCTGG + Intergenic
1180705466 22:17807320-17807342 CAGAGTGCGCAGAGCAGGGCAGG + Intronic
1181311313 22:21946384-21946406 CAGCGTGGCCAGAGACGAGCAGG + Intronic
1181473830 22:23156766-23156788 CCATGCGACCAGGGCAGAGCTGG - Intronic
1181786287 22:25229641-25229663 CAGCGTGTACAGGGCAGAGCAGG - Intronic
1181818458 22:25457464-25457486 CAGTGTGTACAGGGCAGAGCAGG - Intergenic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182063026 22:27411204-27411226 CAGTGTGTTCAGCCCAGAGCTGG - Intergenic
1182416522 22:30224814-30224836 CTGAGTGACCAGAGCAAAGCTGG + Intergenic
1182517218 22:30865736-30865758 GTGTGTGGCCAGTGCAGAGCTGG - Intronic
1182953934 22:34403191-34403213 CAGTATGGCTAGAGCATAGCGGG - Intergenic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184503827 22:44889398-44889420 CAGTGTGACCTGGGCAGAGCTGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1185295618 22:50052294-50052316 CAGTTTGACCACAGCTAAGCAGG - Intronic
949106291 3:203826-203848 CAGTTCTCCCAGAGCAGAGCAGG + Intronic
949376224 3:3393061-3393083 CACTGTGACAACAGCAGAGGTGG - Intergenic
949660706 3:6275315-6275337 CAGTGTGACTGGAACAAAGCAGG - Intergenic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
953358495 3:42274805-42274827 CACTGTTACCAGAACAGTGCAGG + Intergenic
954395959 3:50293437-50293459 CAATGTGACCAGGGCAGCGATGG - Exonic
954636651 3:52074505-52074527 CACTGTGCTCAGTGCAGAGCAGG - Intergenic
956412696 3:68995111-68995133 CAGTTTGCCCAGGGAAGAGCAGG - Intronic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960329753 3:116344224-116344246 CAGTGTAATCACAGCAGAGTTGG - Intronic
960668382 3:120132828-120132850 CAGTGTGATCAGTGGAGTGCAGG + Intergenic
961035560 3:123639223-123639245 AGGAGTGAGCAGAGCAGAGCAGG + Intronic
961262683 3:125615312-125615334 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
961449370 3:126995506-126995528 CAGCAGGACCAGAGCAGGGCTGG - Intronic
961473035 3:127129521-127129543 AAGGGTGCCCAGAGCAGGGCAGG + Intergenic
961829420 3:129615853-129615875 CCGTGTGGGCAGAGCAGAGGAGG + Intergenic
962353135 3:134670425-134670447 CAGTGTGAAGAGAACAGAGTGGG + Intronic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
967119852 3:186373189-186373211 CAAGGTGACCAGTGCAGAGGAGG - Intergenic
968468750 4:766828-766850 CCGTGTGACCAGCTCAGTGCTGG + Exonic
968568868 4:1328980-1329002 CACGGAGGCCAGAGCAGAGCGGG - Intronic
968782885 4:2596481-2596503 CAGTGTGGCCAGGGAAGACCAGG - Intronic
969132446 4:5001849-5001871 CAATCTGACCTTAGCAGAGCTGG + Intergenic
970247322 4:14077110-14077132 GAGTGTGACCTCAGCAGAGGAGG + Intergenic
972387895 4:38585550-38585572 CAGTGTGACCAAGGCACAGTGGG - Intergenic
972872754 4:43320533-43320555 CAATGTTACCAGAGCTCAGCAGG - Intergenic
973068523 4:45827471-45827493 CAGGGTGACTAGAGCTTAGCTGG - Intergenic
974202337 4:58657616-58657638 CACTATTACCAGAGCAGAACAGG - Intergenic
976871491 4:89799365-89799387 CATTGTCACCAGAGCATAGCAGG - Intronic
977495592 4:97771460-97771482 CAGTTTGCCCAGACCAGAGCTGG + Intronic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
978940950 4:114435204-114435226 CTGTCAGACCAGAACAGAGCAGG - Intergenic
979608847 4:122669313-122669335 CATTGTGGCCAGTCCAGAGCAGG - Intergenic
982053148 4:151523614-151523636 CAGTGTGAGCAAAGCAGATATGG + Intronic
982597681 4:157406334-157406356 AAGTGTGACCTCAGCAGAGGAGG - Intergenic
982889208 4:160825732-160825754 CAGTCAGACATGAGCAGAGCAGG + Intergenic
985004020 4:185514672-185514694 CACTGTGGCCAGAACAGAGCCGG + Intronic
985521598 5:376309-376331 CAGTTTCTGCAGAGCAGAGCGGG + Intronic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
986108437 5:4685362-4685384 CAGAGTGACCAGCTCAGAGCAGG + Intergenic
986778699 5:11044832-11044854 GAGTCAGGCCAGAGCAGAGCTGG + Intronic
986909080 5:12532366-12532388 CTGTCTGACCAAAACAGAGCAGG + Intergenic
987005631 5:13706855-13706877 TAGTGATACCAGAGCAGGGCAGG + Intronic
990336143 5:54774638-54774660 CAGCCTGGTCAGAGCAGAGCTGG - Intergenic
992109797 5:73482161-73482183 AAGTGTGACCTCAGCAGAGTAGG - Intergenic
992243050 5:74790562-74790584 AAGGGTGACCTGAGCAGAGGAGG + Intronic
995861437 5:116644868-116644890 CAGCGTGACTAGAACAAAGCAGG - Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
997261886 5:132471667-132471689 CAGTGGGTCCATGGCAGAGCTGG - Intronic
997432394 5:133849361-133849383 CAGACTGCCCAGAGCAGGGCAGG - Intergenic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
999478239 5:151921526-151921548 AAGTGTCAACAGCGCAGAGCTGG + Intronic
999640005 5:153662956-153662978 CAGTGAGGTGAGAGCAGAGCGGG - Intronic
1000040254 5:157479976-157479998 GAGTGTGACCAGAGTAGACTTGG - Exonic
1000406539 5:160893685-160893707 CAGTCTGTCCTGAGCAGAGCTGG - Intergenic
1001295626 5:170496835-170496857 AAGTGAGACTTGAGCAGAGCAGG - Intronic
1001564106 5:172688491-172688513 CTGGGTGCCCAGAGCAAAGCTGG + Exonic
1002095112 5:176826042-176826064 CCCTGTGACCAGACCAGAGTAGG - Intronic
1002569126 5:180130055-180130077 CTGTGTGCCCAGAGCAGGGCTGG + Intronic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003182198 6:3801522-3801544 CAGAATGACCAGGGCAGAGAGGG + Intergenic
1003283402 6:4713205-4713227 CAGTTGGGTCAGAGCAGAGCTGG + Intronic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1006395642 6:33785495-33785517 GAGTGTGTCCAGATCAGAGAAGG + Intronic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1007151846 6:39701283-39701305 CAGTGTGGCCATGCCAGAGCAGG - Intronic
1007424376 6:41737143-41737165 CTGAGCCACCAGAGCAGAGCGGG + Intronic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1010598729 6:77797745-77797767 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1010639190 6:78302037-78302059 CAGTGAGATAAGACCAGAGCTGG - Intergenic
1011170827 6:84502808-84502830 CACTGTGACGAGAACAGTGCAGG - Intergenic
1011247687 6:85336867-85336889 CAGAGTGACCAGAGAAGAAGAGG + Intergenic
1012602706 6:101117503-101117525 TAGTGTGACAGCAGCAGAGCTGG - Intergenic
1013278727 6:108613277-108613299 CAGTGCTACCAGAGCAGAACAGG - Intronic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014631736 6:123797511-123797533 CAGGGTGACCTCAGCAGAGGAGG + Intergenic
1014873886 6:126631533-126631555 CAATGTGATGAGAGCACAGCTGG - Intergenic
1015182701 6:130378091-130378113 CAGTGTGATTAGAACAAAGCAGG + Intronic
1015791581 6:136969096-136969118 GAGGATGACCAGAGCAGAGAGGG + Intergenic
1015955115 6:138590526-138590548 CAGTTTGACAAGATCAGGGCTGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017781292 6:157717412-157717434 CACTCTGACCCGAGCAGGGCGGG - Intronic
1018338893 6:162828481-162828503 CTGTATTTCCAGAGCAGAGCAGG - Intronic
1018345912 6:162899289-162899311 CAGTGTGAAGACAGGAGAGCTGG + Intronic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1019261978 7:86863-86885 CGCTGTGACCAGGACAGAGCGGG - Intergenic
1021784457 7:24138133-24138155 CAGTCAGACATGAGCAGAGCGGG + Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022021076 7:26399464-26399486 CAGTGTGGCCAGGCCAGACCAGG + Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022863962 7:34398176-34398198 CAGTGTGACTACTGCAAAGCAGG + Intergenic
1023816342 7:43953119-43953141 CTGGGTGCCCAGGGCAGAGCAGG + Exonic
1024308757 7:47949941-47949963 CAGTGTGAGAAGAGCAGAGGTGG - Intronic
1024973494 7:55092146-55092168 CATTCTGTCCTGAGCAGAGCAGG - Intronic
1025191317 7:56897956-56897978 GAAGGTGACCAGAGCAGGGCTGG + Intergenic
1025680629 7:63678978-63679000 GAAGGTGACCAGAGCAGGGCTGG - Intergenic
1025957861 7:66196494-66196516 CAGTGACACCAGCGCAGACCAGG - Intergenic
1026375513 7:69746650-69746672 CAGCCTGACTAGAGCAGAGAGGG + Intronic
1026461393 7:70618331-70618353 CAGGGTGACCAGATCACAGGAGG - Intronic
1026561329 7:71452702-71452724 CAGTATGAACTGAGCAGAGCAGG + Intronic
1026827405 7:73593281-73593303 CAGAGTGACCACAGCAGGGCAGG - Exonic
1027190496 7:75993474-75993496 CAGTGTGAGGAGAGCCAAGCAGG + Intronic
1029383177 7:100226557-100226579 CATGGTGACCAGAGCTGGGCAGG - Intronic
1029467787 7:100736988-100737010 CAGTGTTTCCAGAGCACATCGGG - Exonic
1029667211 7:102003435-102003457 GAAGGTGACCAGAGCAGGGCTGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030799232 7:113828835-113828857 CAGTGTGACTACAGCAGCGAGGG + Intergenic
1031501237 7:122519690-122519712 CAGTGTGACCTAAGGATAGCTGG - Intronic
1033545883 7:142399876-142399898 CAGTCTGCCCACAGCAGGGCTGG + Intergenic
1034255572 7:149722910-149722932 CAGGCTAACCAGAGCAGACCTGG + Exonic
1034274238 7:149817058-149817080 CAGGCTCCCCAGAGCAGAGCTGG - Intergenic
1034522075 7:151628200-151628222 AAGTGGTACCAGAGTAGAGCAGG + Intronic
1035262232 7:157669317-157669339 CTGTGTCACCAGAGCAGCGTTGG - Intronic
1035813392 8:2512752-2512774 ATGTGTAACCAGAGCACAGCAGG + Intergenic
1036122838 8:6036696-6036718 CATTGTGAGAAGAGGAGAGCGGG - Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037892878 8:22633135-22633157 TCATGTGAGCAGAGCAGAGCTGG + Intronic
1038893562 8:31755112-31755134 CAGAATGCCCAGAGCAGTGCAGG - Intronic
1039032692 8:33327143-33327165 CTGGGAGACCAGAGCAGTGCAGG - Intergenic
1039719890 8:40151884-40151906 CAGAGTGAGCAGGGCAGAGTGGG - Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1043355062 8:79402203-79402225 CAGTAACACCAGAGCAGAGCAGG + Intergenic
1043609871 8:82049077-82049099 CAGTGTGTCAAGAACAGACCAGG - Intergenic
1044608700 8:94071059-94071081 CGGTGTCGCCAGATCAGAGCTGG + Intergenic
1045387933 8:101689319-101689341 CAGTGCGACCCGAGCAGTGCCGG - Exonic
1046796990 8:118384163-118384185 TAGTGTCACTAGGGCAGAGCAGG + Intronic
1047160232 8:122369925-122369947 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1047398908 8:124529510-124529532 CAGTGTGCCCAAAGCTGTGCAGG + Intronic
1047956655 8:129981723-129981745 GAGTGGGATCACAGCAGAGCAGG + Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1048660786 8:136598896-136598918 CACTATGATGAGAGCAGAGCAGG - Intergenic
1049196013 8:141316044-141316066 CAGAGTGCCTGGAGCAGAGCAGG - Intergenic
1049262621 8:141647761-141647783 CTCTGAGACCAGAACAGAGCAGG - Intergenic
1049367090 8:142245364-142245386 AAGTGTGCTCAGAGCAGTGCTGG + Intronic
1049389406 8:142360314-142360336 GAGTGTGGCAAGGGCAGAGCGGG + Intronic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1052379341 9:27753207-27753229 CAGTGAGATGTGAGCAGAGCAGG + Intergenic
1052380339 9:27764142-27764164 AAGTGTGGCCAGAGCATTGCAGG - Intergenic
1052560403 9:30077450-30077472 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1052893336 9:33723818-33723840 CAGAGTGTGCAGAGCACAGCTGG + Intergenic
1052955322 9:34249523-34249545 AAGTGGGACTAGGGCAGAGCAGG + Intronic
1055554335 9:77460007-77460029 CAGGGAGACCAAAGCAGAGAGGG - Intronic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1055882959 9:81023902-81023924 CAGCGTGGCTAGAACAGAGCAGG + Intergenic
1056106871 9:83355562-83355584 CACTGTGACCTCTGCAGAGCAGG - Intronic
1057183183 9:93040667-93040689 CAGTGTGAGGAGAGCAGGGTAGG - Intergenic
1057754322 9:97819735-97819757 CAGTGGGACCAGCACAGGGCAGG + Intergenic
1057786913 9:98094651-98094673 CAGTGTGACTGGAGAAGGGCAGG + Intronic
1057873641 9:98736430-98736452 CAGTGTGACGGGGGCAGGGCTGG + Exonic
1058506581 9:105672559-105672581 TAGTGTTACCAGAGAAAAGCAGG - Intergenic
1059469473 9:114493789-114493811 CAGTGTGCCCAGGGGAGAACAGG + Intronic
1059600390 9:115770964-115770986 TAATGTGACCAAAGCAGAGTAGG + Intergenic
1059839069 9:118191863-118191885 CGGTGAGACCAGGGCAGTGCTGG + Intergenic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1061544814 9:131298534-131298556 CTGTGGGACCAGCTCAGAGCAGG - Intronic
1061633047 9:131885598-131885620 AAGTGTGACCAGAGGAGGACTGG - Intronic
1061642626 9:131971255-131971277 CACTGTGAAGAGAGCACAGCTGG + Intronic
1061868556 9:133507805-133507827 CAGCAAGACCAGGGCAGAGCTGG + Intergenic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1062166041 9:135107755-135107777 CAGTCGGCCCAGGGCAGAGCTGG - Intronic
1062227743 9:135463086-135463108 CAGAGGGACCATGGCAGAGCCGG - Intergenic
1062292844 9:135804998-135805020 CAGTGTGCCCAGCCCAGGGCTGG + Intergenic
1062547776 9:137071308-137071330 CAGAGTGACCAGATCCCAGCTGG - Intergenic
1203496681 Un_GL000224v1:158212-158234 CAGTGTGATATGAGCACAGCAGG + Intergenic
1203509304 Un_KI270741v1:100134-100156 CAGTGTGATATGAGCACAGCAGG + Intergenic
1186637163 X:11418983-11419005 CAGTGAGACCAGCACAGAGAAGG - Intronic
1187522144 X:20023199-20023221 AAGTGAGATGAGAGCAGAGCTGG + Intronic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189281769 X:39824132-39824154 CTGTGTGTCGAGAGCTGAGCAGG - Intergenic
1190726520 X:53193803-53193825 CAGTGTGACCAGTCCTGAGAAGG - Exonic
1192010153 X:67260652-67260674 CAAATTGACCAGAGAAGAGCTGG + Intergenic
1192236118 X:69297229-69297251 CAGTGAGACCAGAGCAGTGGTGG - Intergenic
1192302084 X:69915649-69915671 CAAAGTGACCAGTGCAGAGTAGG - Intronic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194023317 X:88721200-88721222 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1197084112 X:122452795-122452817 AAGTGTGACCTCAGCAGAGGAGG - Intergenic
1197136041 X:123060742-123060764 GATTGTGACCAGTGCAGAGATGG - Intergenic
1197319014 X:125005630-125005652 CAGTGAGACCAATGCAGAGGCGG + Intergenic
1197711807 X:129676971-129676993 CAGTGTGAACAGAACATAGCAGG - Intergenic
1198132770 X:133715116-133715138 CAGTGTGACTAGAATAAAGCAGG + Intronic
1198383029 X:136102152-136102174 CTATGTGAGCATAGCAGAGCAGG - Intergenic
1199607416 X:149587159-149587181 TGGTGTGACCAGGGCAGGGCTGG - Intronic
1199622417 X:149712790-149712812 TGGTGTGACCAGGGCAGGGCTGG + Intronic
1199628791 X:149762137-149762159 TGGTGTGACCAGGGCAGGGCTGG - Intergenic
1199631707 X:149782208-149782230 TGGTGTGACCAGGGCAGGGCTGG + Intronic
1199642949 X:149881456-149881478 TGGTGTGACCAGAGCAGGGCTGG + Intronic
1199952038 X:152714867-152714889 TTGTGTGACCAGGGCAGGGCTGG + Intronic
1199954677 X:152734044-152734066 TTGTGTGACCAGGGCAGGGCTGG + Intronic
1199957645 X:152753581-152753603 TTGTGTGACCAGGGCAGGGCTGG - Intronic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200688588 Y:6281128-6281150 CAGGGTGACTGGAGCATAGCTGG + Intergenic
1201046685 Y:9893560-9893582 CAGGGTGACTGGAGCATAGCTGG - Intergenic