ID: 950880153

View in Genome Browser
Species Human (GRCh38)
Location 3:16316879-16316901
Sequence CCTGGCATCCTCTCCAGGAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950880144_950880153 9 Left 950880144 3:16316847-16316869 CCAAGCTCTCTGACTTCCTCAGC 0: 1
1: 0
2: 4
3: 49
4: 478
Right 950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG 0: 1
1: 0
2: 0
3: 29
4: 253
950880143_950880153 14 Left 950880143 3:16316842-16316864 CCGTACCAAGCTCTCTGACTTCC 0: 1
1: 0
2: 0
3: 20
4: 260
Right 950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG 0: 1
1: 0
2: 0
3: 29
4: 253
950880146_950880153 -7 Left 950880146 3:16316863-16316885 CCTCAGCATCCCCGTCCCTGGCA 0: 1
1: 0
2: 3
3: 40
4: 495
Right 950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG 0: 1
1: 0
2: 0
3: 29
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950880153 Original CRISPR CCTGGCATCCTCTCCAGGAT TGG Exonic
900373872 1:2344501-2344523 CCTGGCCTCCTCAGCAGCATCGG - Intronic
900876046 1:5343330-5343352 CCTGGCAGCCTCTGGAGCATGGG - Intergenic
901228638 1:7629782-7629804 CCTGCCCTCCTCTCCAGGCTGGG + Intronic
901403644 1:9031797-9031819 CCTGGCACCCACTCCAGTCTCGG - Intergenic
901787479 1:11634326-11634348 CCTGCCTCCCTCTCCAGGTTTGG - Intergenic
902508772 1:16954442-16954464 CCTGGAAGCTTCTCCAGGACAGG - Intronic
902563707 1:17295838-17295860 CATGGCATCTTCTACAGGCTAGG - Intergenic
902976357 1:20091340-20091362 CTTGGGGTCCTCTCCAGTATTGG + Intergenic
902979889 1:20115085-20115107 CGTGGCAGCCTGTCGAGGATCGG - Intronic
903212994 1:21829074-21829096 CCTGGCATCCTCCCCAGGGCTGG - Exonic
903363461 1:22791988-22792010 GCTGGCATGCTCTCCAGCATGGG + Intronic
903656821 1:24954627-24954649 CCTGGGATTCTCCCCAGGACAGG + Intronic
903951702 1:26999476-26999498 CCTGGCGGCCTCTCCAGGGCTGG - Intronic
904365910 1:30010738-30010760 CCTGGCACCCTCGGCAGGGTAGG + Intergenic
905006798 1:34716467-34716489 CCAGGGATCCTCTCCAGGGATGG + Intronic
905058926 1:35122552-35122574 GATGGCTTCCTGTCCAGGATTGG - Intergenic
905081575 1:35326649-35326671 GATGGCATCCTGTCCAGGACTGG - Intronic
905473549 1:38210160-38210182 CCAGGTGTCCTCTCCAGGACTGG - Intergenic
905620603 1:39442790-39442812 GCTGGCATCATCTCCAGCACTGG - Exonic
905795953 1:40816782-40816804 CCTGGCCTCATCTGCAGAATTGG - Intronic
906258481 1:44368319-44368341 CCTGGTATCCCCTCCAGCCTTGG - Intergenic
907182509 1:52583277-52583299 CCTGGCATCCAACCCAGAATTGG - Intergenic
907930980 1:58999985-59000007 CCTCGCATCTTCACCAGCATCGG + Intergenic
907983271 1:59505698-59505720 ACTGTTATCCTCTCCAGGAAGGG - Intronic
907984852 1:59520756-59520778 CCAGGCATCCTCAGCAGGGTAGG - Intronic
909975038 1:82035916-82035938 AATGGCATCCTGTCCAGGGTTGG + Intergenic
912649483 1:111425203-111425225 CCTGGCCTCTTCTCCATGGTGGG - Intronic
915468509 1:156112435-156112457 CCTGGCTTCCTTTCCAGGCTGGG - Intronic
915597865 1:156905564-156905586 CCTGGCCTTGTCCCCAGGATGGG + Intronic
916850181 1:168695637-168695659 ACTGGCAAACTCTCCTGGATTGG - Exonic
920444179 1:206003080-206003102 CCTGGGAGCTTCTCCAGGGTGGG + Intronic
922695792 1:227730297-227730319 CCTGGGATCCTGTCCGGGGTTGG - Intronic
923803043 1:237229124-237229146 CATCGCATCTTCTCCAGGAAAGG + Intronic
924700898 1:246451067-246451089 CCTGGCATAATTTCCAGGACCGG - Intronic
1063368309 10:5504795-5504817 ACAAGCATCCTCTCCAGGAGAGG - Intergenic
1063886895 10:10588828-10588850 ACTGGCATCCACACCAGAATAGG - Intergenic
1065977531 10:30855741-30855763 TCTGGAATACTCTCCAAGATGGG + Intronic
1067522641 10:47019776-47019798 CCTGCCATTGTCTCCAGAATGGG - Intergenic
1069660392 10:70119837-70119859 CCTGGCACCCTGTCCAGGCTTGG - Intronic
1070403156 10:76071021-76071043 CCAGGCATCCTTTCCCGCATTGG - Intronic
1070599717 10:77857209-77857231 CCTTGCATCCTCCCCTGGTTTGG + Intronic
1070669475 10:78367981-78368003 CCTGGCATGCTCTGCAGAAGGGG + Intergenic
1072493956 10:95936089-95936111 CCTGGCATACTCTGCTGGGTGGG - Intronic
1072523850 10:96254230-96254252 CCAGGCATTCTCCCCAGGAAAGG + Intronic
1073733484 10:106319491-106319513 GATGGCATCCCGTCCAGGATGGG - Intergenic
1074125173 10:110523424-110523446 TCTGGCATCTTCTCCTGGGTTGG + Intergenic
1075797991 10:125134811-125134833 CCTGACTCCCTCTCCAGGCTGGG - Intronic
1075855329 10:125624940-125624962 CCTGGCCTCCTCTGCAGTTTTGG - Intronic
1076634352 10:131872822-131872844 CCTGGGAACCTCTGGAGGATGGG - Intergenic
1076677252 10:132153528-132153550 CCTGACACCTTCTCCAGGAGAGG - Intronic
1078090088 11:8259644-8259666 CCTGCCTCCCTCTCCAGGGTTGG + Intronic
1078542545 11:12223480-12223502 TCTGTCAACCTCTCCAGGAAGGG + Exonic
1083258328 11:61509847-61509869 CCTGGAAGCCGCTCCAGGACTGG + Exonic
1083772253 11:64874613-64874635 TCTGGCTTCCTCTCCAGCAGCGG + Intronic
1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG + Intronic
1085791863 11:79503374-79503396 CCTGGAATCCTCACCATGAAGGG - Intergenic
1089588086 11:119522613-119522635 CCTGGCATCCTGTCGAGGGAAGG - Intergenic
1091207975 11:133833732-133833754 CCAGGCAGCCTCTCCCGCATCGG + Intergenic
1091612385 12:2022210-2022232 AATGGCCTCCTGTCCAGGATTGG + Intronic
1091785973 12:3243661-3243683 CCTGGCTTCCTCTTCAGGGAGGG + Intronic
1091917275 12:4278743-4278765 CCTGCCTTCCCCTCCAGGAGTGG + Exonic
1092062617 12:5563749-5563771 CCTGACAACCACTCCAGGGTAGG - Intronic
1095644849 12:44531395-44531417 CCTGGCATTCTCTCCAGGGCTGG + Intronic
1096377463 12:51125082-51125104 CCTCGCATCTTCACCAGCATCGG - Intronic
1096757520 12:53812598-53812620 CCTGCCATGCACTCCAGGCTGGG - Intergenic
1097618656 12:61913799-61913821 CCTGGAATCTTCTTCAGGCTGGG - Intronic
1100212236 12:92409574-92409596 CCTGTAATCCTCCCCAGCATTGG + Intergenic
1101258974 12:103009696-103009718 AATGGCATCCTATCCAGGGTGGG + Intergenic
1103358957 12:120342495-120342517 CCTGCCCTCCTCTCCAGGGCTGG + Exonic
1105614380 13:21999093-21999115 CCTGGCATTCTCTCCAAGAGTGG - Intergenic
1106606695 13:31235134-31235156 CCTGCCATTCTCTCCAGCCTGGG - Intronic
1107699902 13:43036886-43036908 CACGGCATCCACTCCAGGGTGGG - Intronic
1108167815 13:47711093-47711115 TGAGGCTTCCTCTCCAGGATAGG + Intergenic
1108402455 13:50060590-50060612 AATGGCATCCTATCCAGGGTTGG + Intergenic
1109218842 13:59620211-59620233 CCTGGAACATTCTCCAGGATTGG + Intergenic
1111410663 13:87872689-87872711 CATGGCATCCTCTTCAGGGCTGG - Intergenic
1113731152 13:112642360-112642382 CCAGCCCTCCTCTCCAAGATGGG - Intergenic
1114476379 14:22998102-22998124 GCAGGCATCCTCGCCAGGAGAGG + Intronic
1114988158 14:28254438-28254460 CATGGAATGCTCTCCAGGATAGG + Intergenic
1115681417 14:35742962-35742984 AATGGCATCCTGTCCAGGACTGG - Intronic
1115762836 14:36592420-36592442 ACTGTAAGCCTCTCCAGGATAGG + Intergenic
1115873392 14:37832733-37832755 CATGGAATATTCTCCAGGATAGG - Intronic
1117792389 14:59354476-59354498 CCTGGGCTCCTCTACAGGGTTGG + Intronic
1119144510 14:72298888-72298910 CCAGGGAACCTCTCCAGGTTGGG + Intronic
1120711484 14:87797809-87797831 CCTGCCTTCCTCTCCAGTAGTGG + Intergenic
1121107489 14:91290624-91290646 CCAAGCATCCTCTCCAAAATAGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122116860 14:99532101-99532123 ACTGTCATCTTCTCCAGGACAGG - Intronic
1122407377 14:101508588-101508610 TCTGTCATCCTGCCCAGGATGGG - Intergenic
1122830245 14:104392449-104392471 CCTTGCTGCCTCCCCAGGATGGG + Intergenic
1123162823 14:106296048-106296070 CCTGGTATGCTCACCAGCATCGG + Intergenic
1202904520 14_GL000194v1_random:60511-60533 CCTGGCATCCTGCCCTGCATGGG - Intergenic
1126341739 15:47648382-47648404 GATGGCATCCTCTCCAGGGCTGG + Intronic
1128833375 15:70789481-70789503 AATGGCACCCTCTCCAGGGTGGG + Intergenic
1129014147 15:72450980-72451002 CCTTGCATCTTCACCAGCATGGG + Intergenic
1129676248 15:77633594-77633616 CCTGGCTTCCTGTCCAGCAGAGG + Intronic
1130915194 15:88299483-88299505 TCTGCCAGCCTCTCCAGGATTGG - Intergenic
1131392029 15:92057478-92057500 CCTGGGACCCTCTCCATGTTGGG - Intronic
1131561131 15:93441035-93441057 AATGGCATCCTATCCAGGGTTGG + Intergenic
1132342044 15:101085064-101085086 GCTGGCATCCTCTCCGGGGGTGG + Intergenic
1132361102 15:101216244-101216266 CTTTGCATCCTTTCCAGGACTGG - Intronic
1132405809 15:101541373-101541395 CCTGGTCTCCCCTCCAGGAGGGG - Intergenic
1132722555 16:1323900-1323922 CCTGCCAGTCTCGCCAGGATTGG - Intronic
1133001501 16:2853751-2853773 CCTGGCCTCCTCCCCAGAACTGG - Intronic
1134040949 16:11067778-11067800 GCTGGCATCCACACCAGGCTCGG + Intronic
1135423886 16:22322824-22322846 CCTGCCATCCTCACCTGCATTGG + Intronic
1136772490 16:32853862-32853884 CCTGGTATGCTCACCAGCATTGG - Intergenic
1136898125 16:34007655-34007677 CCTGGTATGCTCACCAGCATTGG + Intergenic
1137564480 16:49524695-49524717 CCAGGCGTCCTCCCCAGGGTGGG + Intronic
1138185958 16:54977860-54977882 GATGGCATCCTATCCAGGGTGGG - Intergenic
1138448206 16:57077851-57077873 CCTGGCCTCCTCTCCCGCAGTGG + Intronic
1138586320 16:57972599-57972621 CCTGGCTTCCCCTCCAGTGTTGG + Intergenic
1139548434 16:67660536-67660558 CCTGGAACCCTCTCCAGGGACGG - Exonic
1140267450 16:73433066-73433088 CCTGGCTTTCTCTCCTGGCTGGG + Intergenic
1140953029 16:79837495-79837517 CCTAGCATTTTCTCCATGATTGG + Intergenic
1141069658 16:80942227-80942249 CCAGGCCTCATCTCCAGCATTGG - Intergenic
1203074912 16_KI270728v1_random:1115960-1115982 CCTGGTATGCTCACCAGCATTGG - Intergenic
1143417551 17:6760649-6760671 CCTTGCATCCCATCCAGGAAAGG - Intronic
1143594463 17:7906191-7906213 CCAGGCATCCTCCCCAGGGGAGG + Intronic
1145209698 17:21004047-21004069 GCTGGCATCCTATCCAGAACAGG + Intronic
1145749253 17:27343428-27343450 CCTGACATCCCATCCAGGAGTGG - Intergenic
1145887298 17:28391384-28391406 CCTGGCATCTTCTCCTTCATGGG - Intronic
1147169051 17:38607467-38607489 CCTGGCTGCCTGCCCAGGATGGG + Intergenic
1147900412 17:43779749-43779771 GCTGGCATCTGCTCCAGGAAGGG - Intergenic
1148325011 17:46778236-46778258 CCAGGCATCCTTTCCAGTGTTGG - Intronic
1148670918 17:49409392-49409414 CCTCGCATCTTCACCAGCATCGG - Exonic
1150027993 17:61698408-61698430 CATGGCATGTTCTTCAGGATAGG - Intronic
1150919983 17:69472595-69472617 GATGGCATCCTGTCCAGGTTGGG + Intronic
1151558469 17:74859012-74859034 CCTGGCTTCCCCTCCTGGGTGGG + Intronic
1151772889 17:76176897-76176919 CCTGGCACCCTCGGCAGGGTGGG - Intronic
1152751603 17:82065052-82065074 TTTGGCATCGTCTCCAGGCTGGG + Exonic
1157028526 18:43876496-43876518 CCTGGCAGCTTCTCCAGAGTTGG - Intergenic
1157498017 18:48170372-48170394 CCTGGCAGCCTCTCCAGAGAAGG + Intronic
1160484955 18:79282194-79282216 CATAGCATCTTCTCCAGGAGCGG - Intronic
1162304145 19:9861329-9861351 CCTGGCCTCCACTCCAGCCTGGG + Intronic
1163548774 19:17953512-17953534 TCTGCCCTCTTCTCCAGGATCGG + Intronic
1163630392 19:18415380-18415402 CCCGGCCTCCTCTGCAGGAATGG + Intergenic
1164812043 19:31165007-31165029 CCTGGCATCATCCCCGGGACGGG - Intergenic
1165673206 19:37697071-37697093 CCTCGCATCTTCACCAGCATTGG - Exonic
1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG + Exonic
925026359 2:610271-610293 GCTGCCAGCCTCTCCAGGCTGGG - Intergenic
925835609 2:7943463-7943485 CCCACCAGCCTCTCCAGGATGGG - Intergenic
926708862 2:15859237-15859259 CCTGCGAGCCTCTCAAGGATGGG - Intergenic
927480727 2:23451898-23451920 ACTGGCATCCTCTCCTGGAGAGG + Intronic
927667506 2:25042512-25042534 CCTGGGGTCCTCTCCAGGCCCGG + Intronic
928125361 2:28611836-28611858 CCTGACATCCTTTCAAGGAGAGG - Intronic
928833352 2:35515527-35515549 CCCGGCATCCTCTCAAGGTTAGG + Intergenic
929016400 2:37501340-37501362 CCATGCAACCTCTCCAGGATGGG + Intergenic
929598048 2:43188384-43188406 CCTGGCACCCCATCTAGGATGGG - Intergenic
929856509 2:45642665-45642687 GCAGGCATCGCCTCCAGGATGGG - Intergenic
930124658 2:47785900-47785922 CCTGGAATCCTCTCCATAACGGG - Intronic
930572903 2:53109565-53109587 CCTGACCTCTTCTCCAGGAACGG - Intergenic
932682966 2:73842412-73842434 GATGGCATCCTCTCCAGGGCTGG + Intronic
934074516 2:88416420-88416442 CTTTGCCTCCTCTCCAGGACTGG - Intergenic
934563134 2:95323480-95323502 CCTGGCCACCCCTCCAGGAAAGG + Intronic
936058026 2:109276006-109276028 CATGAAATCCTCTCCAGGATTGG - Intronic
936233831 2:110726294-110726316 ACTGCCATCCTCTCCAGAATTGG - Intergenic
938077644 2:128348276-128348298 GCTGGCCTCCTGCCCAGGATGGG + Intergenic
939482311 2:142764423-142764445 CATGGAATATTCTCCAGGATAGG + Intergenic
940276066 2:151941964-151941986 CCTAGCATCCCCTCCATGTTAGG - Intronic
941024746 2:160446312-160446334 ATTGCCATCTTCTCCAGGATTGG + Intronic
943807267 2:192137621-192137643 CTTGGCACCCTCTCCACTATTGG - Intronic
946027484 2:216680536-216680558 CCTGCCATCCTGCCCAGGTTAGG - Intronic
948065702 2:235077368-235077390 GCTGGCATCCACTGCAGAATCGG - Intergenic
948105678 2:235411880-235411902 CCAGGCCTCCCCTCCAGCATTGG - Intergenic
949050535 2:241895351-241895373 CCTGGCAGCCTCTCTGGGATGGG - Intronic
1171464575 20:25318578-25318600 CCAGGCAGTCTCTGCAGGATTGG + Intronic
1173898858 20:46572206-46572228 CCTGGCAGCCTCCTGAGGATCGG - Intronic
1175315414 20:58043719-58043741 CCTGACATCCTCTCATGGGTTGG - Intergenic
1176226267 20:64001429-64001451 CCAAGCATCCCTTCCAGGATGGG - Intronic
1176623892 21:9075278-9075300 CCTGGCATCCTGCCCTGCATGGG - Intergenic
1179187221 21:39094135-39094157 ACTGGCCTCCTCCCCAGGACAGG - Intergenic
1180984820 22:19898091-19898113 GCTGGCTTCCTCACCGGGATTGG - Exonic
1182281539 22:29220333-29220355 CCTGGCCTCCTCCTCAGGGTAGG - Intronic
1182713695 22:32338701-32338723 CGGGGCACCCTCTCCAGTATGGG - Intergenic
1184676889 22:46048239-46048261 CCAGGGTTCCTCGCCAGGATCGG + Intergenic
950568563 3:13786232-13786254 CCTGGAACCCTCTCCAGGAAGGG + Intergenic
950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG + Exonic
950954237 3:17034271-17034293 GATGGCATCCTGTCCAGGGTGGG + Intronic
951515759 3:23557443-23557465 AATGGCATCCTGTCCAGGGTTGG - Intronic
953331756 3:42059370-42059392 CCTGCTCTCCACTCCAGGATAGG + Intronic
956475546 3:69616524-69616546 TCTGACTCCCTCTCCAGGATTGG + Intergenic
957440800 3:80244514-80244536 GTTGGCATCCTCTCCACAATCGG - Intergenic
959322894 3:104901485-104901507 CATGGAATATTCTCCAGGATAGG - Intergenic
959949113 3:112159487-112159509 CATGGAATATTCTCCAGGATAGG - Intronic
960636748 3:119792129-119792151 CCTCGCATCTTCACCAGGATCGG + Intronic
961098183 3:124175479-124175501 CCAGGCCTGATCTCCAGGATGGG + Intronic
961098209 3:124175611-124175633 CCAGGCCTGATCTCCAGGATGGG + Intronic
961523952 3:127484685-127484707 CCTGGCATCCTCTCTGTGACTGG - Intergenic
961698446 3:128723147-128723169 GCTGGCATCCTGTGCAGGGTTGG - Intergenic
963003282 3:140703389-140703411 ACTGGCATCCTCTTTAGGGTTGG - Intergenic
964548234 3:157858640-157858662 CCTTGCCACTTCTCCAGGATGGG - Intergenic
967086363 3:186098401-186098423 CCTGGCTTCCTCCCCAGGGGAGG + Intronic
969518841 4:7664089-7664111 CCTGCCATCCCCTGCAGGAGGGG - Intronic
969622465 4:8285610-8285632 CCTGGGACCTTCTCCAGGGTGGG - Intronic
970019308 4:11548986-11549008 CCTGTCATTCACTCCAGTATCGG - Intergenic
973734855 4:53861531-53861553 CCAGGACTCCTCTCCAGGAGGGG + Intronic
978593591 4:110353166-110353188 CTTGGCATCATTTCCAGTATTGG - Intergenic
981660837 4:147164690-147164712 GATGGCATCCTGTCCAGGGTGGG + Intergenic
981848639 4:149201017-149201039 CCTTGCCTCCTCCCCAGGACTGG - Intergenic
984598871 4:181703962-181703984 CCAGGCATACTGTCCAGGAACGG + Intergenic
985898258 5:2763548-2763570 CCTGGCCTCCTCTCCAGAGACGG + Intergenic
986297633 5:6452781-6452803 ACTGGCTTCCACTCCAGGCTTGG + Intronic
986851650 5:11819735-11819757 CTTGGCAAACTCTCCAGGAATGG + Intronic
986902045 5:12447817-12447839 CCCTGCATCCTCACCAGCATTGG + Intergenic
986970563 5:13331723-13331745 CCGGGCATCCTCAGCAGGTTGGG - Intergenic
990572270 5:57091007-57091029 CATGGCATCATCACCAGGAGTGG - Intergenic
994793186 5:104258378-104258400 CCTGTCATTCTCTCCAGTTTTGG - Intergenic
996443338 5:123515212-123515234 CCTGTAATCCTCTCCATGCTGGG + Intronic
997750657 5:136342285-136342307 CTTGGCCAGCTCTCCAGGATGGG - Intronic
998169494 5:139864149-139864171 CCTAGCCTGCTCTGCAGGATGGG + Intronic
1001880903 5:175243332-175243354 CCTGTCATGTTCCCCAGGATTGG + Intergenic
1001933880 5:175691249-175691271 CCTGACTTCCTCTCCAGGAGTGG - Intergenic
1002793949 6:455933-455955 CATGGCATCCTCACCAGGGTTGG - Intergenic
1003082399 6:3031987-3032009 CCTGGCATCCTCTGCTGCACAGG - Intergenic
1003671199 6:8161974-8161996 CCAGGCCTCATCTCCAGCATTGG + Intergenic
1005847704 6:29793980-29794002 TCTGACATCCTCAGCAGGATTGG + Intergenic
1006880182 6:37332311-37332333 CCTAGCAGCCTCCCCAGGAAGGG + Exonic
1007901631 6:45419595-45419617 CCTGGCTTCCCTTCCCGGATCGG + Intronic
1008901697 6:56626658-56626680 CTTGGAAGCATCTCCAGGATTGG - Intronic
1010009608 6:71035381-71035403 CATGGCATCATCTCAAGGACTGG + Intergenic
1012248308 6:96952121-96952143 GATGGCATCCTGTCCAGGATGGG + Intronic
1012377951 6:98585378-98585400 CCAGGCTTCCTCTCTAGCATAGG - Intergenic
1018285577 6:162234223-162234245 CCTGGCATCATGTCAAGGCTGGG + Intronic
1018786185 6:167109810-167109832 CCTGGCATGCTCCGCAGGATGGG - Intergenic
1020424172 7:8045239-8045261 AATGGCATCCTGTCCAGGGTTGG - Intronic
1020520425 7:9179023-9179045 TGTGGCATCCTGTCAAGGATGGG - Intergenic
1024095027 7:45976379-45976401 CCTGCCATCCTCACCAGGGCTGG + Intergenic
1024101488 7:46037033-46037055 CCTGTCATCCACACCAGGCTGGG + Intergenic
1024566318 7:50684006-50684028 CCTGCCATGTTCTGCAGGATTGG - Intronic
1024970935 7:55069593-55069615 TTTGTCCTCCTCTCCAGGATTGG + Intronic
1025182042 7:56828226-56828248 CCAGTCAGCCTCTCCAGGCTCGG - Intergenic
1025689886 7:63748769-63748791 CCAGTCAGCCTCTCCAGGCTCGG + Intergenic
1026446400 7:70488318-70488340 CCTGGCGCACTCTCCAGGCTGGG - Intronic
1027241207 7:76330443-76330465 CCTGGCTTCCTCCCCAGAAAAGG + Intronic
1027334570 7:77134762-77134784 AATGGCATCCTGTCCAGGGTTGG + Intronic
1027677890 7:81181794-81181816 CCAGGCCTCATCTCCAGCATTGG - Intronic
1029781276 7:102736846-102736868 AATGGCATCCTGTCCAGGGTTGG - Intergenic
1035252896 7:157608713-157608735 CCTGGCTTCATCTCCAGCCTGGG - Intronic
1035490117 7:159268514-159268536 CCTGGAATATTCTCCAGGATTGG - Intergenic
1035653307 8:1285463-1285485 CCTTCCATCATCTCCAGGACAGG - Intergenic
1037948425 8:23003779-23003801 CCTCCCAGCCTCTCTAGGATGGG - Intronic
1040079399 8:43272041-43272063 CCTGGCAGCCTCTCCCGGAGTGG - Intergenic
1040107002 8:43546981-43547003 CCTGGCACCCACACCAGGGTGGG - Intergenic
1040707356 8:50145106-50145128 CCTGGCATCCTCCCTATGGTTGG - Intronic
1042860298 8:73306269-73306291 CCTCGCATCCACTCCAGTGTGGG - Intronic
1043910227 8:85855309-85855331 GATGGCATCCTGTCCAGGGTGGG + Intergenic
1044763525 8:95547838-95547860 CCAGGGATTCTGTCCAGGATAGG - Intergenic
1046844633 8:118902225-118902247 CCTGGCATCCACTCCATGCATGG + Intergenic
1048363003 8:133714372-133714394 TGTGGCATCTTCTCCAGGCTTGG - Intergenic
1049294224 8:141822067-141822089 CCTTGCATCCTCTCCAAAGTTGG - Intergenic
1050009218 9:1169182-1169204 CCTTGCATCCTCTCCTGGCTCGG - Intergenic
1052645739 9:31231011-31231033 GATGGCATCCTGTCCAGGGTGGG + Intergenic
1054802545 9:69364918-69364940 CTTGGCAGCCCCTCCAGTATAGG + Intronic
1054951676 9:70858906-70858928 CCTTGCTGCCTCTCCAGGATGGG + Intronic
1054952078 9:70863380-70863402 CCTGGCATTTTGTTCAGGATTGG + Intronic
1055099370 9:72447239-72447261 CCAGGCCCCCTCTCCAGTATTGG - Intergenic
1055482767 9:76726075-76726097 ACTGGCATCCTCTACACGGTGGG + Intronic
1056887437 9:90457002-90457024 GATGGCATCCTGTCCAGGGTGGG - Intergenic
1057216146 9:93229995-93230017 CCTGGCATCCCATGCAGGAGAGG - Intronic
1057564550 9:96156290-96156312 TCTGCCAGCCTTTCCAGGATGGG + Intergenic
1060559298 9:124529709-124529731 CCTGACATCCTCCCAAGGTTGGG - Intronic
1061048604 9:128180891-128180913 CCTGTCATCCCCTGGAGGATGGG - Intronic
1061287570 9:129632875-129632897 TCTGGCGTGCTCTCCAGGAGAGG + Intronic
1062056455 9:134471707-134471729 CCTGGGATCCTCTTCAGCCTGGG + Intergenic
1062070231 9:134551433-134551455 CCTGGCATCCTCCGCAGGTGAGG + Intergenic
1062272967 9:135718192-135718214 CCTGGTCTCCACTCCAGGAAGGG - Intronic
1062723652 9:138058849-138058871 CCTTGCATCCTGGCCAGCATGGG + Intronic
1203747077 Un_GL000218v1:45706-45728 CCTGGCATCCTGCCCTGCATGGG - Intergenic
1187115419 X:16345095-16345117 CATGTCAACCTCTCTAGGATTGG + Intergenic
1189666872 X:43365190-43365212 CCTAGTATCTTCACCAGGATCGG - Intergenic
1191844176 X:65534199-65534221 TCCGGCATCCTCTCCAAGTTGGG + Intronic
1192361357 X:70442490-70442512 AATGGCATCCTGTCCAGGATTGG + Intergenic
1192430104 X:71106058-71106080 GCTGGCATACTCTGCATGATTGG + Exonic
1196184086 X:112726732-112726754 CCTGTCATCCTCTTGAGGAAAGG - Intergenic
1196709930 X:118752240-118752262 CCTGTCAACCTCTCCAGACTCGG + Intronic
1197094481 X:122576462-122576484 CCAGGCACCATCTCCAGTATTGG + Intergenic
1199967858 X:152834692-152834714 CTTGGCCTCCTCTGCAGGACTGG - Intronic
1200047253 X:153409461-153409483 CCTGTCATCCTCTCTAGGTTGGG + Intergenic
1200089432 X:153627494-153627516 CCTGTCATCCTCTCTAGGTTGGG - Intergenic
1200518380 Y:4178748-4178770 CCTGGCAGCAACTTCAGGATAGG + Intergenic
1201160398 Y:11160701-11160723 CCTGGCATCCTGCCCTGCATGGG - Intergenic
1201263026 Y:12178939-12178961 CCAGGCTGCATCTCCAGGATTGG - Intergenic