ID: 950880630

View in Genome Browser
Species Human (GRCh38)
Location 3:16320166-16320188
Sequence CTTCAAGTAGTTTAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950880627_950880630 -9 Left 950880627 3:16320152-16320174 CCATGATGTGTCCACTTCAAGTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 950880630 3:16320166-16320188 CTTCAAGTAGTTTAGCTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 135
950880626_950880630 -8 Left 950880626 3:16320151-16320173 CCCATGATGTGTCCACTTCAAGT 0: 1
1: 0
2: 1
3: 8
4: 133
Right 950880630 3:16320166-16320188 CTTCAAGTAGTTTAGCTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 135
950880625_950880630 25 Left 950880625 3:16320118-16320140 CCAATGGATTTAATTTGCACATT 0: 1
1: 0
2: 2
3: 27
4: 396
Right 950880630 3:16320166-16320188 CTTCAAGTAGTTTAGCTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950880630 Original CRISPR CTTCAAGTAGTTTAGCTGGA AGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902932100 1:19738717-19738739 GCTCAAGCAGTTTAGCTGCATGG + Intronic
908248437 1:62246276-62246298 CTTCAAGTAGGCTGGCTCGATGG + Intronic
908915647 1:69122686-69122708 GTTCAAGTAGTTTACATGGGAGG + Intergenic
911700907 1:100950845-100950867 GTGCAAGTAGTTTATCTGGGAGG + Intronic
911790401 1:102008227-102008249 CTCCAAATAGTTTTGCTGAAAGG - Intergenic
912582218 1:110730738-110730760 CTACAAGTAGTTTATTTGGAAGG - Intergenic
915194751 1:154181274-154181296 CTTTAAGTATTTAAACTGGAGGG + Intronic
915685783 1:157631804-157631826 CTTCAAGTAGTGTATCTAGACGG - Intergenic
916641003 1:166729225-166729247 CTTCAAGTAGTTCATCCAGAAGG + Intergenic
917529893 1:175825411-175825433 CTGAAAGTGGCTTAGCTGGATGG + Intergenic
919149186 1:193673540-193673562 ATTCAACTAGTCTAGCTGCAAGG - Intergenic
919915871 1:202138785-202138807 CTTCAAGTTCTCTTGCTGGAAGG - Intronic
924028363 1:239862321-239862343 GTTCAAGAAGTTAAGCTGCAGGG - Intronic
1064840981 10:19591792-19591814 CTTCAAGAAGTGTGGCCGGATGG - Intronic
1065043674 10:21725173-21725195 CTTCTAGTATTTTAGCTACAGGG - Intronic
1068353078 10:55874899-55874921 ATTCAAGTACTATAGCTGTAAGG + Intergenic
1069564981 10:69457770-69457792 CTTCAGGTAGGTTAGGTGCATGG - Intronic
1071105260 10:82086306-82086328 CTTCAAGGATTCTAGCTGGAAGG + Intronic
1074027103 10:109647675-109647697 CCTGAAGTACATTAGCTGGAGGG - Intergenic
1078467426 11:11560566-11560588 TGTCAAGGAGTTCAGCTGGAAGG + Intronic
1080326782 11:31083934-31083956 ATTCAACTAGTTTATCTGTAAGG + Intronic
1082669649 11:56018679-56018701 CTTCAAATAGTTTAAATGGGAGG + Intergenic
1083866728 11:65458856-65458878 CTGGGAGTAGTTTAGCTGGGAGG + Intergenic
1086581244 11:88401967-88401989 CTTCAAGGAGTTTAGGTTAAAGG - Intergenic
1087029792 11:93690931-93690953 CTTCATGTTGTTTACCTGGCTGG + Intronic
1087929441 11:103959818-103959840 CTTCAAGTTGTTTACTTGGAGGG - Intronic
1091229887 11:133981432-133981454 CTTGAAGTAGGAAAGCTGGAGGG + Intergenic
1093637732 12:21491820-21491842 CTTGAAGTAGTATAGCAGAATGG + Intronic
1098161845 12:67653202-67653224 CTTCAAGAGGCTGAGCTGGAGGG + Intronic
1098790943 12:74820993-74821015 ACTCAAGAAGTTTAGCTGTAGGG - Intergenic
1100334784 12:93618988-93619010 CTTAAAGGAGTTTAACTGAAGGG + Intergenic
1101094350 12:101320930-101320952 CTTCAAGTAACTTACCTGTAAGG - Exonic
1101864354 12:108509132-108509154 CTGGGAGCAGTTTAGCTGGATGG - Intergenic
1102160841 12:110767365-110767387 CTGCAAGTTGTTTATTTGGAGGG - Intergenic
1102392893 12:112563756-112563778 CTGCAAGTAGTTTATTTGGGAGG - Intergenic
1102703327 12:114859427-114859449 ATGCAAGTAGTTTTGCAGGATGG + Intergenic
1104431197 12:128717745-128717767 TTGGAAGTAGTTTAGCTGGGTGG - Intergenic
1112605995 13:100906901-100906923 CTGCAAATAGTTTAGCTGATAGG + Intergenic
1113109204 13:106803773-106803795 CTTTAAGTATTTTTGTTGGATGG + Intergenic
1113408492 13:110063351-110063373 CTCCAGGGAGTTTAACTGGATGG - Intergenic
1116341438 14:43727988-43728010 CTTCATTTATTTTAGCTGGTAGG - Intergenic
1120155161 14:81085285-81085307 CTGCCAGTAGTTTAGCTAAATGG - Intronic
1125113610 15:36062940-36062962 GTTCAGGTAGTTTATTTGGAAGG - Intergenic
1137066504 16:35850928-35850950 CTTCAAGGAGTTATGCTGAACGG - Intergenic
1140076248 16:71701145-71701167 CTAGGAGCAGTTTAGCTGGAGGG - Intronic
1140647541 16:77049510-77049532 ATCCAAGTAGTTTATTTGGAAGG - Intergenic
1145041861 17:19582940-19582962 CTTCAAGAAGCTTGGCTTGAAGG + Intergenic
1145042549 17:19587770-19587792 CTTCAAGAAGCTTGGCTTGAAGG - Intergenic
1150444434 17:65217595-65217617 TTTCAAGTAGTTTGGGAGGAAGG + Intronic
1151769442 17:76150405-76150427 CAACAAGCAGGTTAGCTGGAGGG + Intronic
1151875454 17:76865658-76865680 CTGCAAGTGGTTTATTTGGATGG + Intergenic
1155384488 18:25262391-25262413 CTTCAAGTAGTGTAACAAGACGG - Intronic
1161464898 19:4423696-4423718 CGTCAAGCATTTTAGCTTGAAGG - Intronic
1166173981 19:41052450-41052472 CTTCATGGATCTTAGCTGGAAGG + Intergenic
1168371226 19:55836196-55836218 CTTCAAGGAGTTTAGCATGTAGG + Intronic
1168372654 19:55849153-55849175 TTCCAAGTAGCTTAGATGGATGG - Intronic
928622336 2:33103798-33103820 CTTCAAGTTGTTGAGAAGGATGG - Intronic
929656490 2:43737491-43737513 CTAGAAGCAGTTTAGCTGGGTGG + Intronic
933043988 2:77509934-77509956 CTTGAAGTACTTTAGGTTGATGG - Intronic
933410843 2:81922591-81922613 CCCTAAGTAGTTTAGATGGAGGG + Intergenic
935759933 2:106311120-106311142 CTTCAAGGAGTTTTGCTGAAAGG - Intergenic
942249442 2:174034818-174034840 TTTCAAGTTCTTTGGCTGGAAGG + Intergenic
943357007 2:186868682-186868704 CTTCAAGTAGGGAAGCTGGTGGG + Intergenic
943733448 2:191327966-191327988 CTCACAGTAGTTCAGCTGGAAGG + Intronic
1171260383 20:23726799-23726821 TTTCAAGTGGCTTATCTGGAAGG + Intergenic
1174146897 20:48458640-48458662 GTTCAAGTAGTTTATCTGGGAGG + Intergenic
1175438817 20:58976078-58976100 TTGCAAGCAGTTTAGCTGGATGG + Intergenic
1178769627 21:35490972-35490994 GTGCAAGTAGTTTATTTGGAAGG + Intronic
1179343454 21:40533886-40533908 CTTCAAGTGGTTTCCCTGAAAGG + Intronic
1181421921 22:22806768-22806790 CTTCAAGTAATTTCACAGGAGGG - Intronic
1182003806 22:26942430-26942452 CATGAAGTATTTCAGCTGGAAGG + Intergenic
950880630 3:16320166-16320188 CTTCAAGTAGTTTAGCTGGAAGG + Intronic
952321447 3:32281608-32281630 ATTCAAGAAGTTTTGCTGCAAGG - Intronic
953582127 3:44166868-44166890 GTTCAAGTAGTTTATCTGGGAGG - Intergenic
953903255 3:46855049-46855071 CTGCAAGTAGTCTCCCTGGAAGG - Intergenic
955501629 3:59590775-59590797 CTTCAAGAAGCTTAGCTCCATGG - Intergenic
956738936 3:72259819-72259841 GTACAAGTAGTTTATTTGGAAGG - Intergenic
956757277 3:72401317-72401339 CTGGGAGTAGCTTAGCTGGATGG - Intronic
958516145 3:95118371-95118393 CATTAAGTAGGTTAGCTGTAGGG + Intergenic
963231838 3:142915940-142915962 TTTCAAGAAGTATAGCTGAAAGG - Intergenic
963608404 3:147434450-147434472 CTTAAAGTAGTTTAAGTTGAAGG + Intronic
963772746 3:149405439-149405461 GTGCAAGTAGTTTATTTGGAAGG + Intergenic
964168705 3:153740352-153740374 CTTCATGGGGTTTAGCTGAATGG - Intergenic
970573693 4:17407039-17407061 CTTAAAGTAGTTTAGGTAAAAGG - Intergenic
970863724 4:20735253-20735275 CATCCAGTAATATAGCTGGAGGG - Intronic
971775356 4:30956648-30956670 CATAAAGTATTTTACCTGGAAGG + Intronic
972298403 4:37762137-37762159 CTTCAAGTAGTTTATTTGGGAGG + Intergenic
973791604 4:54383288-54383310 AGTCATGTAGATTAGCTGGAAGG + Intergenic
974859608 4:67503517-67503539 CTTCCAGAAATTAAGCTGGAGGG + Intronic
975687072 4:76927329-76927351 CTACAAGTAGTTTATTTGGGAGG - Intergenic
978381746 4:108135798-108135820 CTCCAAGCAGGTTAGCTTGAAGG - Intronic
979690388 4:123553102-123553124 ATTCAAGTAATTTAGGTGGTTGG - Intergenic
982864871 4:160498337-160498359 GCTCAAGTAGATTAGCTGGGAGG + Intergenic
985942305 5:3147020-3147042 CTACAGGTAGTTTACATGGAAGG - Intergenic
987186214 5:15422159-15422181 CTGGCAGTGGTTTAGCTGGATGG - Intergenic
988604110 5:32665717-32665739 CCTCAAGTATTTGAGCTGGCAGG + Intergenic
993373986 5:87127365-87127387 GTACAAGTAGTTTATTTGGAAGG - Intergenic
996317502 5:122177007-122177029 GTTCAAGTAGTTTATTTGGGAGG + Intronic
1001137556 5:169115102-169115124 CTTCAAGTGGCTGAGTTGGATGG - Intronic
1001892315 5:175349928-175349950 CTTCAAGCTGCTTAGCTGGGGGG - Intergenic
1001967190 5:175918961-175918983 CTGAAAGCAGCTTAGCTGGATGG - Intronic
1001967706 5:175923554-175923576 CTGAAAGCAGCTTAGCTGGATGG - Intronic
1002249744 5:177920251-177920273 CTGAAAGCAGCTTAGCTGGATGG + Intergenic
1006260317 6:32862581-32862603 CTACAAAAAATTTAGCTGGATGG + Intergenic
1008737878 6:54569257-54569279 CTTTAAATAATTTATCTGGATGG + Intergenic
1010083333 6:71887615-71887637 CTTGGAGTTGTTTAGCTGGTCGG + Intronic
1010097353 6:72062553-72062575 GTTCAAGTAGTTTATTTGGGAGG + Intronic
1010272294 6:73928271-73928293 CTTGTAGGAGTTTTGCTGGAAGG - Intergenic
1010510124 6:76708139-76708161 GTTCAAGTATTTTAGTTGAATGG - Intergenic
1011036924 6:82987255-82987277 CTTCAAGTAGCTGAGGTGGAAGG - Intronic
1015729952 6:136337608-136337630 GTACAAGTAGTTTATCTGGGAGG + Intergenic
1022224738 7:28351380-28351402 CTTCACGTAGTCTAGCAGTATGG - Intronic
1022240810 7:28511076-28511098 CTTCAGGTAGTTTACCTCTAGGG + Intronic
1024029743 7:45449088-45449110 CTACAAGTAGGAGAGCTGGATGG - Intergenic
1027642264 7:80751032-80751054 CTTCAAGTATGTTAGCTGGTAGG - Intronic
1028450140 7:90972994-90973016 CTTCAAGTACTTTTTTTGGAAGG + Intronic
1029255412 7:99266288-99266310 GTGCAAGTAGTTTATCTGGGAGG - Intergenic
1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG + Intronic
1030571685 7:111234017-111234039 CTTTAAGTAATGTAGTTGGATGG + Intronic
1030779190 7:113577564-113577586 CTTGAAGTATTTTACCTTGAAGG + Intergenic
1030970359 7:116047720-116047742 CCTCAAGTAGCTTAACTGGGAGG + Intronic
1033667066 7:143451575-143451597 CTTCAAGTAGTTTCTTTGCAAGG - Intergenic
1039697315 8:39926517-39926539 CTTCTAGGGGCTTAGCTGGAGGG + Intronic
1043105073 8:76098419-76098441 CTTCACATAGTTTATCTTGAAGG + Intergenic
1043832025 8:85001183-85001205 CCACAAATAGTTTAGCTGGATGG + Intergenic
1044065293 8:87691121-87691143 CTTCAAGGAGTTTCTCTGAAGGG + Intergenic
1044475118 8:92616947-92616969 TTTCAAAAAGTTTTGCTGGAAGG - Intergenic
1045843026 8:106601488-106601510 CTTCTAGTATATTAGATGGAAGG - Intronic
1050473621 9:6018584-6018606 CTTCAAAAAGTCTAACTGGAGGG + Intergenic
1051212806 9:14763123-14763145 CTTCAAGTCATTTAGCAGGAGGG + Intronic
1051759597 9:20447309-20447331 CTTCACTTAGTTTCTCTGGAAGG - Intronic
1056765017 9:89439833-89439855 CTTCACGAATTTTAGCTGAATGG + Intronic
1057417073 9:94873264-94873286 ATTCAAGTATTTTATCTGGGAGG - Intronic
1057705753 9:97393841-97393863 CTTCAGGTAGCTTAGGGGGAAGG - Intergenic
1058061702 9:100504059-100504081 TTTCAAGTAGTTTAGAAAGATGG - Intronic
1058126617 9:101202579-101202601 ATGCAAGTAGTTTATCTGGGTGG + Intronic
1060225444 9:121787285-121787307 ATTCAAGAAGTTTGGCTGAAGGG - Intergenic
1189067444 X:37825432-37825454 CTTCATGCAGTTTAGCTGTGTGG - Intronic
1189205420 X:39234192-39234214 TTTCAAGAAGTTGAGCTGAATGG + Intergenic
1189279363 X:39810405-39810427 GTACAAGTAGTATATCTGGAAGG + Intergenic
1191699172 X:64021044-64021066 CATCAAGTATTTTAGCTAGGAGG + Intergenic
1192308775 X:69991486-69991508 CTTCTAGTAGTGAAACTGGATGG - Intronic
1194299459 X:92167640-92167662 TTTCCAGTAGTTTAACTAGATGG - Intronic
1194771423 X:97911399-97911421 CTTCGTGTAGTTTAGGTGGAGGG - Intergenic
1196366477 X:114930093-114930115 CATCATGTAGTTTACATGGAAGG + Intergenic
1196456451 X:115894624-115894646 CTACAAGGTGTTTAGGTGGAAGG + Intergenic
1197359558 X:125483239-125483261 CTTCAAGTCTTTCACCTGGAAGG - Intergenic
1197610446 X:128632474-128632496 CCTCAAGTGCTTTAGATGGAAGG - Intergenic
1200617106 Y:5392769-5392791 TTTCCAGTAGTTTAACTAGATGG - Intronic