ID: 950881416

View in Genome Browser
Species Human (GRCh38)
Location 3:16325754-16325776
Sequence GATCCTGGTGAGCCAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950881405_950881416 20 Left 950881405 3:16325711-16325733 CCCCTGGTGCACTGACCCACTGT 0: 1
1: 0
2: 0
3: 12
4: 126
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271
950881409_950881416 5 Left 950881409 3:16325726-16325748 CCCACTGTGACCTAATGTGGAAT 0: 1
1: 0
2: 0
3: 12
4: 121
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271
950881406_950881416 19 Left 950881406 3:16325712-16325734 CCCTGGTGCACTGACCCACTGTG 0: 1
1: 0
2: 0
3: 28
4: 147
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271
950881410_950881416 4 Left 950881410 3:16325727-16325749 CCACTGTGACCTAATGTGGAATC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271
950881404_950881416 21 Left 950881404 3:16325710-16325732 CCCCCTGGTGCACTGACCCACTG 0: 1
1: 0
2: 1
3: 28
4: 273
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271
950881412_950881416 -5 Left 950881412 3:16325736-16325758 CCTAATGTGGAATCTGAGGATCC 0: 1
1: 0
2: 0
3: 15
4: 193
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271
950881407_950881416 18 Left 950881407 3:16325713-16325735 CCTGGTGCACTGACCCACTGTGA 0: 1
1: 0
2: 0
3: 6
4: 203
Right 950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950881416 Original CRISPR GATCCTGGTGAGCCAGAGGA GGG Intronic
900983491 1:6059800-6059822 GGTCCTGGTGAGCAAGAGGAAGG + Intronic
901218495 1:7568315-7568337 GATGCTGGTGATCCTGATGAGGG - Intronic
901961828 1:12832759-12832781 GATCCTGGATAGCAAGAGGCCGG - Intergenic
902670081 1:17967072-17967094 GATGCTGGAGAGCCAGAGCTGGG - Intergenic
903005419 1:20295052-20295074 GATCCTAGGGGCCCAGAGGAGGG + Intronic
904041833 1:27589924-27589946 GAGCCTGGTGCAGCAGAGGAGGG - Intronic
904945546 1:34196366-34196388 GATCCTGGTGAATCAGTGCAGGG + Intronic
905253769 1:36666601-36666623 GATTCTGAGGAGCCAGAGGGAGG - Intergenic
905790157 1:40785189-40785211 GAGCCTGGTGAGAGGGAGGAGGG - Intronic
905999993 1:42416412-42416434 GATCTTGGTGGGCAGGAGGAGGG - Exonic
906688609 1:47778354-47778376 GCTTCTGGTGAGGCAGAGGCAGG - Intronic
907190039 1:52640827-52640849 GCTCCTGGAGAGCCTTAGGATGG + Intronic
912413544 1:109493602-109493624 GAACCTGGTGGACCAAAGGAGGG - Intergenic
912608084 1:111013487-111013509 GATGCTGGTGAGGCTGTGGAGGG + Intergenic
913357635 1:117940887-117940909 GATACTCTTGAGGCAGAGGATGG + Exonic
913695233 1:121318215-121318237 GACCCAGATAAGCCAGAGGATGG - Intronic
914142331 1:144961845-144961867 GACCCAGATAAGCCAGAGGATGG + Intronic
915360664 1:155284636-155284658 GAGCATGGTGAGCCAGACGTCGG - Exonic
915947437 1:160163843-160163865 GTTCCTGGATAGCCACAGGATGG - Intronic
916462573 1:165042065-165042087 GATCCTGGTTAGCCAGAGCATGG - Intergenic
916463372 1:165048795-165048817 AATCCTGGAGAGTTAGAGGAGGG - Intergenic
917066534 1:171100748-171100770 AATCCTTGGGAACCAGAGGATGG + Intronic
917692397 1:177482717-177482739 GCTCCTGGGGAGGCAGAGGAAGG + Intergenic
918138865 1:181703042-181703064 GATACTTGAGAGGCAGAGGAAGG - Intronic
919619468 1:199848627-199848649 GAGGCTGGTGGGCCTGAGGATGG - Intergenic
919944613 1:202310178-202310200 GATCCTGGTGGGGGAGAGGCAGG - Exonic
920482564 1:206336594-206336616 GACCCAGATAAGCCAGAGGATGG - Intronic
923122830 1:231009565-231009587 CATCATGGTGAGCCAAAGAAAGG + Intergenic
1063380562 10:5582951-5582973 TATCCTGGGGAGCCAGAGGGGGG - Intergenic
1065191122 10:23210108-23210130 GATTCTGGTGACCCAGTGGATGG + Intronic
1065827844 10:29588109-29588131 AATTCTGGTGAGCCAGTGGGTGG - Intronic
1065950020 10:30643193-30643215 AATTCTGGTGAGCCAGTGGGTGG + Intergenic
1066281155 10:33919458-33919480 GATCCTGGGTAGCCTCAGGATGG - Intergenic
1067081575 10:43215477-43215499 GATCCTGGTGGGCCTCAGGAGGG + Intronic
1067142949 10:43671437-43671459 GATGCTGGAGAGACAGAGAAGGG - Intergenic
1069388111 10:67903204-67903226 GCTACTGGGGAGACAGAGGAGGG - Intronic
1070982260 10:80659191-80659213 GATCATGGTGACCTACAGGAGGG + Intergenic
1071371652 10:84957642-84957664 GCTCCTGGAGAGCCTCAGGATGG + Intergenic
1071390544 10:85170998-85171020 GATCCTGGAGAGCAGCAGGAGGG + Intergenic
1072634522 10:97169389-97169411 GATCCTGGTGGGAGAGAGGGTGG - Intronic
1075517108 10:123118058-123118080 GAGCCTGGGGAGCCAGGGGAGGG + Intergenic
1075595647 10:123727258-123727280 CTTCCTGATGGGCCAGAGGATGG - Intronic
1076260225 10:129059233-129059255 GATTATGGTGTGCCAGGGGATGG + Intergenic
1076673766 10:132137178-132137200 GCCCCTTGGGAGCCAGAGGACGG - Intronic
1077155488 11:1089152-1089174 GAGCCTGGGGAGGCAGAGGGAGG - Intergenic
1077337031 11:2009997-2010019 GAGCCTGGCGAGGAAGAGGAGGG - Intergenic
1078893580 11:15578833-15578855 AATGCTAGGGAGCCAGAGGAGGG - Intergenic
1079137336 11:17783276-17783298 GATCCTGTTGGGTCAGGGGAGGG + Intergenic
1080255324 11:30283987-30284009 GATTTTGGTGAGGCAGTGGAAGG + Intergenic
1081436423 11:43032393-43032415 GATACTAGTGAGGCAGAGGCTGG - Intergenic
1081473005 11:43394192-43394214 GAGCCTGGTGAGCAAGAGGAAGG + Intronic
1082835312 11:57646918-57646940 TAGCCTGGTGCGCGAGAGGAGGG + Intronic
1082960521 11:58914828-58914850 TATCCTAGTGAGACAGAGTAGGG - Intronic
1083471588 11:62887902-62887924 GATACTGGGGAGGCTGAGGAGGG - Intronic
1083806815 11:65079337-65079359 GATCTTGGTGAGTGAGAGGCAGG - Exonic
1084687029 11:70702511-70702533 GATGCTGGTGAAGAAGAGGATGG - Intronic
1085047097 11:73359970-73359992 GACACTGGGGAGCCAGAGGGTGG + Intronic
1086607133 11:88709350-88709372 GATCATGGAGAGCCAGGGTAAGG + Intronic
1086882335 11:92163311-92163333 GAGCCTGGTGAGCTACAGGGAGG - Intergenic
1087379052 11:97381179-97381201 GATACTGGGGAGGCTGAGGAGGG - Intergenic
1089051370 11:115548894-115548916 GGAGATGGTGAGCCAGAGGAAGG + Intergenic
1089374818 11:117986657-117986679 GATCCAGGTTTGCCAGAGTAAGG - Intronic
1089672561 11:120066637-120066659 GTTCTTGGTGAGGAAGAGGAAGG + Intergenic
1089707108 11:120286395-120286417 GATCCAGGCGGGCCAGAGCACGG + Intronic
1089858504 11:121568131-121568153 GCTCCTTGGGAGGCAGAGGAGGG - Intronic
1090920057 11:131199166-131199188 GATCCCTGTGAGCCAGGGGCTGG - Intergenic
1202820015 11_KI270721v1_random:65179-65201 GAGCCTGGCGAGGAAGAGGAGGG - Intergenic
1092238888 12:6825732-6825754 GCTCCTTCTCAGCCAGAGGATGG + Intronic
1095089281 12:38088731-38088753 GAGCCTGGTAAGCGAGAGGTGGG - Intergenic
1096107199 12:49003287-49003309 GATTCTGGGGAGACAGAGGAAGG + Exonic
1096292717 12:50355024-50355046 GATACTGCTGAGCCACAGAAAGG - Exonic
1096330192 12:50705061-50705083 GAACTTGATGAGCCAGAGGATGG + Intronic
1096998557 12:55856247-55856269 GATCCTGGGGAGGCAGAGCAGGG + Intergenic
1099379448 12:81937005-81937027 GATGTTTGTGTGCCAGAGGATGG - Intergenic
1100342218 12:93690204-93690226 GATTCTGGTGTCCTAGAGGAAGG - Intronic
1101758809 12:107642593-107642615 GAAGTTGGTGAGCCACAGGAAGG + Intronic
1102975037 12:117200736-117200758 AATCATTGGGAGCCAGAGGATGG + Intergenic
1103086666 12:118066787-118066809 TTTCCTGGTGAGCCACAGAATGG + Intronic
1104697288 12:130872565-130872587 GTTCCTGCGGAGGCAGAGGACGG - Exonic
1105032650 12:132894921-132894943 GAGCCTGATGAGCAAGGGGAAGG - Intronic
1105650297 13:22370099-22370121 GCTCCTGGGGAGCCTGGGGATGG - Intergenic
1105740033 13:23314683-23314705 GATATTTGTGTGCCAGAGGATGG + Intronic
1106457981 13:29944265-29944287 GCTCCTGGTCAGCCAGAAGGAGG - Intergenic
1106630155 13:31463337-31463359 GATACTGGGGAGCCTGAGGCAGG - Intergenic
1108904215 13:55449479-55449501 GATATTTGTGTGCCAGAGGATGG + Intergenic
1111998962 13:95192547-95192569 AATGCTGTTGAGCTAGAGGAAGG - Intronic
1113634211 13:111908916-111908938 GAACCTGGGGAGGCAGAGGTTGG + Intergenic
1114074481 14:19149178-19149200 GAGCCTGGGCAGCCAGAGAAGGG - Intergenic
1114087787 14:19250797-19250819 GAGCCTGGGCAGCCAGAGAAGGG + Intergenic
1116375199 14:44190623-44190645 GATCCCCGTGTGTCAGAGGAGGG + Intergenic
1116849094 14:49891301-49891323 GATACTGGTGAGGCTGAGGTGGG + Intergenic
1120131714 14:80815937-80815959 GATACTGGAGACCCAGAGGGTGG + Intronic
1121112192 14:91320164-91320186 GCTCCTGGAGAGCCTCAGGATGG + Intronic
1121297457 14:92840873-92840895 GTTCCTTGTGAGCCTGAGGTGGG - Intergenic
1125770288 15:42160725-42160747 CATCCTGGGGATCCAGCGGATGG - Exonic
1126916994 15:53477048-53477070 GAGCCTGGAGAGACAGAGCAAGG - Intergenic
1127367640 15:58306423-58306445 GAGGCTGGGGAGCCAGAGAAAGG - Intronic
1127836947 15:62797706-62797728 GCTCCTTGTGGGCCAGAGCAGGG + Intronic
1129077010 15:73005560-73005582 GAGCCTTGTGGGCCACAGGAAGG + Intergenic
1129109582 15:73329672-73329694 GAGCATGGTGAGCCAGACGTCGG + Exonic
1129262054 15:74374108-74374130 GATCCAGGAGAGCCAGAACAGGG + Intergenic
1130843965 15:87726923-87726945 AAACCAGGTGAGTCAGAGGAGGG + Intergenic
1131838196 15:96410534-96410556 GATCCAGGTCGGCCTGAGGATGG + Intergenic
1132849275 16:2017236-2017258 GAGTCTGGTGAGCCTGACGAGGG - Intronic
1133914588 16:10097622-10097644 GATCCTAGTGAGCCAGAGGTGGG + Intronic
1135617603 16:23925421-23925443 CATCCTGGTTAACGAGAGGAGGG - Intronic
1135687923 16:24513271-24513293 CATTCTGGTGTGCCACAGGATGG + Intergenic
1136525711 16:30828838-30828860 GAGCCTGGTGGGCCACAGTAAGG - Intergenic
1139589726 16:67926923-67926945 GATCCTGGTCATCCAGAGATTGG + Intronic
1140841629 16:78844849-78844871 GTCCCTGGTGAGCTAGAGCAAGG - Intronic
1141097693 16:81174663-81174685 GACCCTGGGGCCCCAGAGGAAGG + Intergenic
1142812778 17:2403018-2403040 GAACTTCGTGAACCAGAGGAAGG + Intergenic
1143048875 17:4105765-4105787 GATCCTGGTGAGAGAGAGAGTGG + Exonic
1143109354 17:4544735-4544757 GATCCGGGTGAGCCTGGGGGCGG - Exonic
1144862997 17:18317482-18317504 GAACTGGGTGAGACAGAGGAAGG + Exonic
1148871823 17:50662970-50662992 GTTCCTGAGGAGGCAGAGGAAGG + Intronic
1150021394 17:61617546-61617568 GATCCTGATGGGACAGTGGAAGG - Intergenic
1150591653 17:66567884-66567906 GATCTTCGTGAGCCAGTGGATGG + Intronic
1150949658 17:69788976-69788998 GATGCTAGGGACCCAGAGGAGGG + Intergenic
1151517975 17:74608909-74608931 AATCCTGCTGAGCAATAGGAAGG + Intergenic
1151593216 17:75060598-75060620 GAACCTGGCGAGCCAGAGCGGGG - Intronic
1152048156 17:77952474-77952496 GAGAATAGTGAGCCAGAGGAGGG - Intergenic
1152095764 17:78270683-78270705 GTCCCTGGTGAGGCTGAGGAGGG + Intergenic
1154255600 18:12778433-12778455 GATGCTGGTGAGCAAGCGCAAGG - Intergenic
1154498553 18:14980742-14980764 GATCCTGGGGATCCTTAGGATGG - Intergenic
1156268379 18:35508684-35508706 CATGCTGGTTAGCAAGAGGAAGG - Intergenic
1156310486 18:35918003-35918025 GCTACTGGGGAGGCAGAGGAAGG - Intergenic
1156391291 18:36652775-36652797 GAGCCTGGTGTGGCGGAGGAGGG - Exonic
1157346828 18:46845161-46845183 GATTCTGGTTAGTCATAGGAGGG - Intronic
1157585050 18:48795665-48795687 GATTCTGGGGAACCAGAGGAAGG - Intronic
1162128198 19:8510762-8510784 GATCTGGGTGGGGCAGAGGAGGG + Exonic
1162480131 19:10922914-10922936 GTTCCAGGGGAGCCATAGGAGGG + Exonic
1162789686 19:13056324-13056346 GATCCTTGGGAGGCAGAGGAGGG + Intronic
1163398586 19:17078182-17078204 AATCCTTATGACCCAGAGGACGG + Intronic
1164580905 19:29434258-29434280 GAGCCTGGTATGGCAGAGGACGG - Intergenic
1165654125 19:37518460-37518482 GATATTGGTGAGCCACAGAATGG - Intronic
1166186265 19:41141136-41141158 GATCCTGGGGCTCCAGAGGCAGG + Intergenic
1166749511 19:45158332-45158354 TACCCTGCTGAGCCAGAGGAGGG + Intronic
1166780685 19:45340969-45340991 GATCCCGGAGAGCCCCAGGACGG - Intronic
1167508806 19:49884962-49884984 GATCTAGGTGAGCATGAGGACGG - Intronic
1167534167 19:50039026-50039048 GATTCTTGTGAGGCTGAGGATGG + Intronic
932477043 2:72012919-72012941 ATTCCTTGTGAGCCAGAAGATGG + Intergenic
936059227 2:109283552-109283574 GATCCTGGTGAGCAGGATGGGGG + Intronic
936451792 2:112639319-112639341 GGTACTGGGGAGGCAGAGGAAGG + Intergenic
937882918 2:126881951-126881973 GCTCCCAGTGAGCAAGAGGAGGG + Intergenic
938488819 2:131745674-131745696 GAGCCTGGGCAGCCAGAGAAGGG - Intronic
941444921 2:165588848-165588870 GCTACTGGTGAGGCAGAGGTGGG + Intronic
942160530 2:173181268-173181290 GCTACTTGTGAGGCAGAGGATGG + Intronic
943168022 2:184357254-184357276 GAGGCTGGTGTGCCAGAGCAGGG + Intergenic
943450638 2:188038888-188038910 GAGCCAGGTGAGCCAGGAGAAGG - Intergenic
943590255 2:189787193-189787215 GATACAGGTGAGCTGGAGGATGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944535712 2:200707545-200707567 GCTCCTGGTTAGCCTGAGAATGG - Intergenic
946149538 2:217754981-217755003 GATGCTGGTGAGAGAGAGGATGG - Intronic
946510619 2:220351767-220351789 GAGCCTGGTGACCTACAGGATGG + Intergenic
947796810 2:232898313-232898335 GATCCGGGTGATCCAGAGCCAGG - Intronic
948464446 2:238145546-238145568 CAACGTGGTGAGCCAGAGGTGGG - Intronic
1174372135 20:50098058-50098080 GATCCTGGTGTTCCGGAGGAGGG + Intronic
1175855363 20:62118164-62118186 GATCCTGGTGGAACAGAAGACGG - Intergenic
1175995046 20:62808228-62808250 GATCCTGAAGAGCCAGAGAAAGG - Exonic
1176239175 20:64067999-64068021 GATCAAGGGGAGGCAGAGGAGGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178047471 21:28711574-28711596 GAACCTGTTGATCTAGAGGAGGG + Intergenic
1178684317 21:34699361-34699383 GATCCTTGTGAGGCTGAGGTGGG - Intronic
1178876136 21:36415578-36415600 CATCCTGGTGAGCCAGGGAGTGG + Intronic
1178955470 21:37017998-37018020 GAAGCTGAAGAGCCAGAGGAAGG + Exonic
1179049352 21:37875432-37875454 CAACCTGGAGAGCCAGAGGTGGG + Intronic
1179617972 21:42593908-42593930 GACCCTGGTCAGCCACAGCATGG - Intergenic
1179777176 21:43672624-43672646 GAGCCTGGAGAGCCAGATGCAGG + Intronic
1180290127 22:10842118-10842140 GAGCCTGGGCAGCCAGAGAAGGG - Intergenic
1180492925 22:15871540-15871562 GAGCCTGGGCAGCCAGAGAAGGG - Intergenic
1181602484 22:23960622-23960644 GACTCTGGTGGGCCAGGGGAGGG + Intronic
1181606029 22:23980685-23980707 GACTCTGGTGGGCCAGGGGAGGG - Intronic
1181906624 22:26202355-26202377 CATCCTCCTGAGCCACAGGAAGG + Intronic
1182681414 22:32082802-32082824 GACCCTTTTGAGCCAGAAGATGG - Intronic
949482045 3:4503294-4503316 TGCCCTGGTGAGCCACAGGATGG + Intronic
950679197 3:14573419-14573441 GATCCTGGTGTGCAGGAAGAGGG + Intergenic
950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG + Intronic
951649454 3:24934171-24934193 GGTCCTAGCTAGCCAGAGGAGGG + Intergenic
952458409 3:33497590-33497612 GATCCTGATGAGAGAGAAGATGG - Exonic
952495617 3:33913553-33913575 GGGCCTGGTGGGCCAGAGTAGGG - Intergenic
952752559 3:36837104-36837126 GATCCTGAGGATCCAGAAGAAGG - Intronic
954945327 3:54419197-54419219 GACCCTGGTGGCCCACAGGATGG + Intronic
956167663 3:66408587-66408609 TACACTGGTGAGTCAGAGGATGG + Intronic
956739777 3:72266779-72266801 GATGCTGAGGAGCTAGAGGATGG - Intergenic
960556652 3:119037427-119037449 GATCATGGTGGGGCAGAGGTGGG - Intronic
960803354 3:121560337-121560359 GATACTGAAGAGCCAGATGAAGG + Intergenic
961349489 3:126290543-126290565 AATTCTTGTGAGACAGAGGAAGG - Intergenic
961414779 3:126749305-126749327 GATCATGGTGACCCAGACAAAGG + Intronic
961673442 3:128550680-128550702 GGTCCTGGTGAGATGGAGGAAGG - Intergenic
964252289 3:154732634-154732656 GAATCTGATCAGCCAGAGGAAGG - Intergenic
967109119 3:186277764-186277786 AAACCTGGTGAGCACGAGGAAGG - Intronic
968164392 3:196452751-196452773 GCTCCTGGGGAGGCGGAGGAGGG + Intergenic
968215334 3:196884782-196884804 GCTCCTGGTGAGGCTGAGGCAGG - Intronic
969904454 4:10381410-10381432 GATCCTGGAGCCCCAGAGGATGG + Intergenic
970250334 4:14108396-14108418 GATCTTAGTGAGTCTGAGGAAGG + Intergenic
970824282 4:20253599-20253621 GCTCCTGCTCTGCCAGAGGAGGG + Exonic
971266766 4:25102732-25102754 GCTCCTGGGGAGGCTGAGGAGGG + Intergenic
972805832 4:42528841-42528863 GATATTTGTGTGCCAGAGGATGG + Intronic
974593842 4:63991129-63991151 GACACTGGAGATCCAGAGGAGGG + Intergenic
976147385 4:82055383-82055405 GATGCTGGTGAGCAAGAGAAAGG + Intergenic
977621448 4:99142252-99142274 GGTCCTGGGTATCCAGAGGAAGG - Intronic
982187636 4:152818971-152818993 GTACCTGGGGAGCCAGAGAAAGG + Intronic
982208209 4:153013311-153013333 GATTCAGGTGAGAAAGAGGAGGG - Intergenic
983229457 4:165114436-165114458 GACCCTGGGGAGCCTGAGGCAGG - Intronic
984782137 4:183535426-183535448 GAGCATGGTCAGCCATAGGAAGG + Intergenic
985191919 4:187383330-187383352 GTTCTTGGCAAGCCAGAGGAAGG + Intergenic
985706702 5:1405731-1405753 GATGCTGCTGAGCCAGAGGGAGG + Intronic
985890431 5:2711444-2711466 GTTCCTGGAGAGGCTGAGGAGGG - Intergenic
986044509 5:4024342-4024364 GATCCCGTTGAGCCTGTGGAAGG + Intergenic
986423095 5:7603593-7603615 GCTACTGTTGAGCCTGAGGAAGG + Intronic
986725528 5:10593752-10593774 GATCCAGGTGAGCCAGGGTCAGG - Intronic
986807911 5:11326338-11326360 GTTCCTGGGGAGTCAGAGGCTGG + Intronic
987230873 5:15892251-15892273 GGTCCCTGTGAGCAAGAGGAAGG + Intronic
987400482 5:17470485-17470507 GGCCCTGGTGAGCCAGGTGATGG + Intergenic
989541767 5:42626646-42626668 GCTCCTGGAGAGCCTCAGGATGG - Intronic
990747487 5:58974917-58974939 GCACCTGATGACCCAGAGGAGGG - Exonic
991686567 5:69187574-69187596 GATTGTGGTGAGACAGTGGAAGG + Intergenic
992154026 5:73936970-73936992 GATAATGGTGAGCCAATGGAGGG + Intronic
992656742 5:78917975-78917997 GATGCTGATGAGCCAGCGTAAGG - Intronic
994695065 5:103063642-103063664 GATCATGGGAAGCCAGAGCAAGG - Intergenic
994947589 5:106415782-106415804 GATCCTGTTCATCCATAGGATGG + Intergenic
995269637 5:110205960-110205982 GATATTTGTGTGCCAGAGGATGG - Intergenic
995582430 5:113615912-113615934 GGGCCTGATGAGCCAGAGGAAGG - Intergenic
996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG + Intergenic
996276189 5:121668736-121668758 GATCGTGGAGGGCCAGGGGATGG + Intergenic
997714588 5:136032702-136032724 GATCTTCCTGAGCCAGAGGCAGG - Intronic
997952360 5:138252674-138252696 GATCCTGGTAGTCAAGAGGAAGG + Exonic
999173947 5:149618463-149618485 GATTCTGAAGAGCCAGTGGAGGG + Intronic
999510443 5:152245134-152245156 GAGCCAGGTGGGCCAGTGGAAGG + Intergenic
999654814 5:153801287-153801309 CACCCTGTGGAGCCAGAGGAAGG - Intronic
999654844 5:153801449-153801471 CACCCTGTGGAGCCAGAGGAAGG - Intronic
999859853 5:155633608-155633630 GAGCCTGCTGGGACAGAGGAGGG - Intergenic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1001040858 5:168334110-168334132 GCTACTGGTGAGGCTGAGGAGGG + Intronic
1001109387 5:168883296-168883318 GATCCAGGGGATCCCGAGGAAGG - Exonic
1002319471 5:178366325-178366347 TAACCTGGTGCACCAGAGGATGG - Intronic
1002689243 5:181038769-181038791 GGGCCTGGGGAGACAGAGGAGGG - Intergenic
1003546359 6:7062729-7062751 GATGCTCTTGAGCCAGAGGAGGG + Intergenic
1006001489 6:30968584-30968606 GATATTTGTGTGCCAGAGGATGG + Intergenic
1006241086 6:32679644-32679666 GAGCCTGGCAATCCAGAGGAGGG - Intergenic
1006258375 6:32848932-32848954 GATGGTGCTGGGCCAGAGGAAGG + Intronic
1007023154 6:38543072-38543094 GAACATGGTGAGTCAGGGGAGGG - Intronic
1007335475 6:41152148-41152170 GTTCCTGGTGTGGCATAGGATGG - Intronic
1007429856 6:41770579-41770601 GATCATGGTGGGGCAGAGGGTGG + Exonic
1011427719 6:87248848-87248870 GACCATGGTGGGCCAGAGGATGG + Intronic
1012108646 6:95198230-95198252 GACACTTGTGTGCCAGAGGATGG - Intergenic
1012138859 6:95595356-95595378 GAAACTGGCTAGCCAGAGGAAGG - Intronic
1012730391 6:102873825-102873847 GAAACTTGTGTGCCAGAGGATGG + Intergenic
1018291017 6:162292721-162292743 GATCCTGGTGGGTCTAAGGAAGG - Intronic
1020066236 7:5190422-5190444 GAACCTGGCGAGCCAGAGCGGGG + Exonic
1024762706 7:52619371-52619393 GATCCTGGGGAGCCTGAAGCCGG + Intergenic
1026735681 7:72947039-72947061 AATCCTGGAGAGGCAGACGAGGG - Intronic
1026786023 7:73301970-73301992 AATCCTGGAGAGGCAGACGAGGG - Intergenic
1026805861 7:73429413-73429435 GCGCCTGGGAAGCCAGAGGAGGG - Intergenic
1027108041 7:75417972-75417994 AATCCTGGAGAGGCAGACGAGGG + Exonic
1028162952 7:87507023-87507045 GATCCTGTTGAGGCAGATAAAGG + Intronic
1028237752 7:88382338-88382360 GATATTTGTGTGCCAGAGGATGG + Intergenic
1028492164 7:91424553-91424575 AATCCTGGGGTCCCAGAGGAGGG + Intergenic
1028699271 7:93757875-93757897 GTTCCTGATGAACCAGAGAAGGG + Intronic
1028760410 7:94489771-94489793 GCTACTGGTGAGGCTGAGGAAGG - Intergenic
1029117200 7:98243427-98243449 GATCGTGGGGAGCCAGGGCAGGG + Intronic
1029434356 7:100554018-100554040 CAACCTGGGGAGCCAGAGGAGGG + Intronic
1034233350 7:149549728-149549750 GGTCCTGGAGTGCCTGAGGACGG + Intergenic
1039477237 8:37845875-37845897 GATCCTGCTGAGACAGAGCTGGG + Intronic
1040073168 8:43204698-43204720 GTTCCTGGTGGGGCAGTGGACGG - Intergenic
1042520622 8:69707725-69707747 GGTCCTTGTGAGCCACAGTAGGG + Intronic
1042943315 8:74129570-74129592 GATCCTGCAGAGCCAGCTGAGGG + Intergenic
1044024693 8:87154372-87154394 GAAGCTGGTGAAGCAGAGGAGGG + Intronic
1045347891 8:101310972-101310994 GCTCCTGGATAGCCTGAGGATGG - Intergenic
1046102990 8:109635857-109635879 GATCTTGCAGAGCCAGTGGAGGG - Intronic
1047161734 8:122388082-122388104 GATACTGGAGAGTTAGAGGAGGG + Intergenic
1049055375 8:140232348-140232370 GATCTTGGGGAGCAAGTGGAGGG + Intronic
1049185997 8:141253899-141253921 GATCCTCTGGAGGCAGAGGATGG - Intronic
1049204516 8:141357492-141357514 GATGCAGGTGAGGAAGAGGATGG + Exonic
1049213957 8:141399258-141399280 GGACCAGGCGAGCCAGAGGAGGG - Intronic
1052882072 9:33607517-33607539 GATACTGGGAAGCCTGAGGAAGG + Intergenic
1053494240 9:38538244-38538266 GATACTGGGAAGCCTGAGGAAGG - Intergenic
1053506449 9:38647671-38647693 GATCCTTGGGAGGCAGAGGCAGG - Intergenic
1054353181 9:64037649-64037671 GCTCCTCGGGAGCCAGAGGCAGG + Intergenic
1056408385 9:86299058-86299080 GCTGCAGGTCAGCCAGAGGAAGG + Intronic
1058886790 9:109327718-109327740 GATCCTGGTGATCTTGAGGAGGG + Intergenic
1059371481 9:113843013-113843035 GAGCTTGGTGAGGCAGAAGATGG - Intergenic
1060053553 9:120393824-120393846 GACGCTGGGGATCCAGAGGAGGG - Intronic
1060075163 9:120584166-120584188 GATCATGGTGAGACAGAGACAGG - Intergenic
1060396145 9:123318346-123318368 GTTTCTGGTGAAACAGAGGAAGG + Intergenic
1060856977 9:126922078-126922100 GGTACTGGTGAGGGAGAGGACGG + Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061164703 9:128915699-128915721 GCTCCTGGTGAGCCCTGGGATGG + Intronic
1061326429 9:129867477-129867499 GAGCAGGGGGAGCCAGAGGAAGG + Intronic
1061922246 9:133788605-133788627 TAGCCTGGTGAGCCAGGTGAGGG - Intronic
1062609656 9:137368295-137368317 ATTGCTGATGAGCCAGAGGAAGG + Intronic
1187204475 X:17169288-17169310 CATCCTGATGAGCTAGAAGATGG + Intergenic
1189315977 X:40056759-40056781 GGTCCTGCTGAACCAGCGGAGGG + Intronic
1189549167 X:42075407-42075429 GAGCCTGGTGTGCCATGGGAAGG + Intergenic
1196841283 X:119861671-119861693 GATCCTGGATAGCCTCAGGATGG + Intergenic
1197065165 X:122225983-122226005 GATCAGGGTGAGCAACAGGAAGG - Intergenic
1199170158 X:144726158-144726180 GTACTTGGAGAGCCAGAGGACGG + Intergenic
1199860956 X:151800154-151800176 GATCCTGGAGCCCCTGAGGATGG - Intergenic