ID: 950881803

View in Genome Browser
Species Human (GRCh38)
Location 3:16328368-16328390
Sequence GTTCCCAAAGGGCCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 202}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950881803_950881807 3 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881807 3:16328394-16328416 ACCAGCTCATCTGGATGCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 229
950881803_950881816 26 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881816 3:16328417-16328439 GCGAGTGGGATGGAAGGCAGAGG 0: 1
1: 0
2: 1
3: 57
4: 704
950881803_950881811 12 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881811 3:16328403-16328425 TCTGGATGCCCTGGGCGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 128
950881803_950881806 -6 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881806 3:16328385-16328407 GGGAACAAAACCAGCTCATCTGG 0: 1
1: 0
2: 1
3: 11
4: 132
950881803_950881814 20 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881814 3:16328411-16328433 CCCTGGGCGAGTGGGATGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 233
950881803_950881809 4 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881809 3:16328395-16328417 CCAGCTCATCTGGATGCCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 213
950881803_950881810 11 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881810 3:16328402-16328424 ATCTGGATGCCCTGGGCGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 114
950881803_950881817 29 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881817 3:16328420-16328442 AGTGGGATGGAAGGCAGAGGAGG 0: 1
1: 1
2: 8
3: 151
4: 1954
950881803_950881812 16 Left 950881803 3:16328368-16328390 CCTGCTGGTGGCCCTTTGGGAAC 0: 1
1: 0
2: 0
3: 21
4: 202
Right 950881812 3:16328407-16328429 GATGCCCTGGGCGAGTGGGATGG 0: 1
1: 0
2: 0
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950881803 Original CRISPR GTTCCCAAAGGGCCACCAGC AGG (reversed) Intronic
902843253 1:19088869-19088891 GTTCCCGCAGGGCTTCCAGCAGG + Exonic
903545503 1:24121217-24121239 CTTCAGAAAGAGCCACCAGCTGG - Exonic
903971181 1:27119840-27119862 GTTCCCAAAGGGCCAGCGGTAGG + Intronic
904012055 1:27395563-27395585 TTCCCCAAATGGCCACCAGAGGG - Exonic
904035372 1:27556076-27556098 TTGCCCATAGGGACACCAGCTGG + Intronic
904737717 1:32647503-32647525 GTTCCTAACAGGCCACCAACTGG - Intronic
910590238 1:88922423-88922445 GTTCCTAACAGGTCACCAGCTGG - Intergenic
911530344 1:99036620-99036642 GTTCCCATTGGGGCACCACCTGG - Intergenic
915255760 1:154627519-154627541 GGTACCAAAGGCCCAACAGCTGG - Intronic
915666238 1:157447784-157447806 CTTCCCAGAGGGCTCCCAGCAGG + Intergenic
916393291 1:164357039-164357061 GCTCCCAAAAGGCCACCGTCTGG + Intergenic
917054644 1:170967231-170967253 GTTCACTAAGTGCCACCAGGTGG + Intronic
919656637 1:200203114-200203136 GATCCCAAAGGTGCAGCAGCTGG + Intergenic
920550377 1:206855663-206855685 GTTCCTAACAGGCCACCAACCGG + Intergenic
920649717 1:207827668-207827690 GTTCCCAGATGGTCCCCAGCAGG - Intergenic
1064018604 10:11791758-11791780 GTTCCCAAGAAGTCACCAGCAGG - Intergenic
1067243122 10:44513215-44513237 GTACCCAAATGGCCCCTAGCTGG + Intergenic
1074098714 10:110336154-110336176 GTTCCAAAAGCGCGACAAGCAGG - Intergenic
1074533287 10:114311322-114311344 GTTTCCAAAGGGCTTCCAGGTGG - Intronic
1074826113 10:117216759-117216781 TTTCCCAAGCGGCCACCAGGTGG + Intergenic
1075853061 10:125604174-125604196 GTTCCTAACAGGCCACCAACTGG - Intronic
1075977912 10:126712814-126712836 GTTCCTAATGGGCCACAAACTGG - Intergenic
1076076831 10:127540096-127540118 GCCACCAAAGGGCCACAAGCAGG - Intergenic
1077521383 11:3037441-3037463 GTTCTTAAAGGGTGACCAGCAGG + Intronic
1081263652 11:40991900-40991922 GTTCCTAACAGGCCACCAACTGG + Intronic
1081263659 11:40991937-40991959 GTTCCTAAGAGGCCACCAACTGG + Intronic
1081662153 11:44894730-44894752 CATCCCCAAGGGCCTCCAGCTGG + Intronic
1083233236 11:61336372-61336394 GTTCCCACCGGGCCACCAGGTGG + Intronic
1084657757 11:70528951-70528973 GCTCCCACAAGGCCACCAGTGGG - Intronic
1084666715 11:70580356-70580378 GTGTCCAGGGGGCCACCAGCAGG + Intronic
1085315503 11:75542460-75542482 GTGCCCAAAGGGGCAGCAACAGG - Intergenic
1085760035 11:79233737-79233759 GTTCACAAAGGGCCACCTGGAGG - Intronic
1089680783 11:120117783-120117805 TTTCCCAAAGGGGCGCCTGCAGG + Intronic
1090194550 11:124803205-124803227 CTCCCCAAAGGGCCACAGGCAGG + Intergenic
1090520057 11:127469536-127469558 GTTCCCAAAGGTCCTACAACAGG - Intergenic
1095762354 12:45853915-45853937 GTTCCTAAAGGGCCACGGACTGG - Intronic
1099270068 12:80497491-80497513 GTTCCTAACAGGCCACCAGCTGG + Intronic
1102245525 12:111353363-111353385 GTTGCCCAATGGCCCCCAGCTGG - Intergenic
1102528699 12:113530507-113530529 GTTCCCACTGGGGCACCACCTGG + Intergenic
1102815311 12:115860604-115860626 TTTCCCAAAGGGGCACCTGGTGG + Intergenic
1103176672 12:118869956-118869978 GTTCTACAAGGGACACCAGCTGG - Intergenic
1103894746 12:124265464-124265486 GTGACCAAACAGCCACCAGCAGG - Intronic
1103898195 12:124288290-124288312 GTTTCCACAGGGCCACTAGAAGG + Intronic
1104731326 12:131107081-131107103 AGTCCCCTAGGGCCACCAGCTGG - Intronic
1106586044 13:31056823-31056845 GCTCCCAGATGGCCACCAGCTGG - Intergenic
1106810340 13:33352722-33352744 CTTCCAACAGGGCCAGCAGCCGG - Intergenic
1113373957 13:109746514-109746536 GTTCCCAAAGGGCCTACTGTGGG - Intergenic
1115521199 14:34234624-34234646 GAAGGCAAAGGGCCACCAGCAGG - Intronic
1115753546 14:36513578-36513600 CTTCCCACCGGGCCAGCAGCAGG + Exonic
1117019505 14:51555136-51555158 TTTACCAAAGGGCCACCAGATGG + Intronic
1119815516 14:77563359-77563381 GGTCCCACAGGGCCAACTGCAGG - Intronic
1122632216 14:103112234-103112256 GTTCCCAGAGGCCCACCTACGGG + Intergenic
1122848501 14:104513779-104513801 AGACCCAAAGGGCCACCACCAGG + Intronic
1122953899 14:105061105-105061127 GTTCCCACCGGGCCTCCTGCTGG - Intronic
1124366522 15:29075517-29075539 GTTCCCAAAGGGACATCATTAGG - Intronic
1129659725 15:77546424-77546446 GTTACCTAAGAGCCTCCAGCTGG - Intergenic
1130045486 15:80440944-80440966 ATTCCCAAAGGGCCTCCATGGGG - Intronic
1131407263 15:92175585-92175607 GTTCTTAAAAGGCCACCAACGGG - Intergenic
1131496726 15:92918117-92918139 TTTCCCAAATGGCCACAAGAGGG - Intronic
1131798816 15:96048503-96048525 CTTCCCAACGTGCCACCTGCAGG + Intergenic
1132065678 15:98728730-98728752 GATCACCAAAGGCCACCAGCTGG - Intronic
1132870200 16:2112458-2112480 ATCCCCAAAGGTCCACCTGCCGG + Exonic
1133809259 16:9148622-9148644 GTTCCTAAAGGGCCAGGAACTGG + Intergenic
1134522343 16:14924498-14924520 ATCCCCAAAGGTCCACCTGCCGG - Intronic
1134710013 16:16323149-16323171 ATCCCCAAAGGTCCACCTGCCGG - Intergenic
1134717228 16:16363149-16363171 ATCCCCAAAGGTCCACCTGCCGG - Intergenic
1134949590 16:18345496-18345518 ATCCCCAAAGGTCCACCTGCCGG + Intergenic
1134957523 16:18389010-18389032 ATCCCCAAAGGTCCACCTGCCGG + Intergenic
1136113632 16:28080651-28080673 GGTCACAAAGAGCCACCACCTGG + Intergenic
1139201705 16:64984182-64984204 GCTGCCAAAGGGCCACTAGGGGG - Intronic
1141767587 16:86068823-86068845 CAGCCCAAATGGCCACCAGCAGG + Intergenic
1141772550 16:86099593-86099615 GTTCCCAACAGGCCACCTACTGG + Intergenic
1142187789 16:88702636-88702658 ATTCCCACAGAGCCACCACCTGG + Intronic
1143121060 17:4607227-4607249 GTTCCCAAGGACCCACCAGCGGG - Intronic
1144239091 17:13292408-13292430 CTTTCCAAACTGCCACCAGCTGG + Intergenic
1145066744 17:19766542-19766564 CTTCCCAAGGGGTCGCCAGCAGG - Intergenic
1145925118 17:28641130-28641152 GTTCCCACAGGGACAACTGCTGG - Intronic
1147918334 17:43901493-43901515 GTGCCCAAGAGGCCACCATCAGG + Intronic
1149442435 17:56686025-56686047 GTTCCTAAAGGGCTACTGGCAGG - Intergenic
1149703146 17:58672229-58672251 GTTCCTAACAGGCCACCAACTGG + Intronic
1150666895 17:67148232-67148254 GTTCCGCAGGGGACACCAGCTGG - Intronic
1151716759 17:75835045-75835067 GTTCACCCAGGGGCACCAGCTGG + Exonic
1151984050 17:77530629-77530651 GTTCCTAAAGGGCCACAGACCGG + Intergenic
1152652645 17:81502709-81502731 GATTCCAAACGACCACCAGCAGG + Intergenic
1152676822 17:81645462-81645484 GGCCCCAGAGGGCCACCACCAGG - Exonic
1153671323 18:7415169-7415191 GTTACCCAAGGGCCCCCAGGGGG + Intergenic
1157184585 18:45528004-45528026 GTGCCCATAGGGCCACCATTAGG + Intronic
1157858658 18:51122514-51122536 GTTCCCAAAGGCCAGGCAGCAGG - Intergenic
1158810080 18:61021759-61021781 GTTCCTAACAGGCCACCAGCAGG - Intergenic
1160049596 18:75420569-75420591 GTTGCAAAAGGGCCATCAGGAGG + Intronic
1161794513 19:6378711-6378733 ATTCCCACAGAGCCCCCAGCTGG + Intronic
1162421487 19:10568405-10568427 GTTCCCAGTGGGTCACCACCAGG + Intronic
1162456622 19:10788848-10788870 CTTCCCACAGGGACACCAGGAGG + Intronic
1162819327 19:13213009-13213031 GTTCCACAAGAGCCACCAGAGGG + Intronic
1162842978 19:13369910-13369932 TTTCCCAGAGGATCACCAGCAGG - Intronic
1162870354 19:13581629-13581651 GTTCCCGCAGGCCCACCCGCAGG + Intronic
1162973702 19:14196203-14196225 TTTCCCCCAGGGCCACCAGAGGG + Intronic
1163457657 19:17417680-17417702 GTCCCCAAAAGGCCACCGTCTGG - Intronic
1163713898 19:18863107-18863129 GGCCCCACAGGGCCCCCAGCAGG - Intronic
1164567554 19:29338628-29338650 GTGCACAAATGGCCACCAACTGG - Intergenic
1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG + Intronic
1165319144 19:35075104-35075126 GGTCCCACATGGCCACCAGCAGG - Intergenic
927415103 2:22871316-22871338 ATTCCCAAAGGGCAATCAGGAGG + Intergenic
929533140 2:42764595-42764617 GTTCCCTCCAGGCCACCAGCAGG - Intergenic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
932760858 2:74438404-74438426 GTTCGCAAATGTCCACCAGGTGG - Intronic
933157550 2:78992589-78992611 TTTACCAAACGGCCACCAGAGGG + Intergenic
937259610 2:120577027-120577049 ATTCCCAAAGCGCCAACAGAAGG - Intergenic
941250423 2:163154737-163154759 TTTCCCACACGGCCACAAGCAGG + Intergenic
941268332 2:163392160-163392182 GTTCCCAAAGGTCCACTCTCAGG - Intergenic
941703754 2:168635267-168635289 GCTCCCTCAGGGACACCAGCTGG - Intronic
942120848 2:172775211-172775233 GCTCCCAAAGGGCCAGCAAATGG - Intronic
946334859 2:219029843-219029865 TTCCCCACAGGGCCACCAGGGGG + Intronic
947461319 2:230306789-230306811 TTGCCCAAAGGGGCACCTGCAGG - Intronic
947753058 2:232542769-232542791 GTGCCCTAAGGAGCACCAGCAGG - Intronic
948397946 2:237661428-237661450 GTTCCCCAAAGCCCTCCAGCTGG + Intronic
1173987795 20:47276104-47276126 GTCCCCAAAAGGCCACCTGGAGG - Intronic
1175165537 20:57041303-57041325 GTCCCCAAGGGGCCAGAAGCGGG - Intergenic
1175367894 20:58467911-58467933 GTTGCAAAAGGCCCTCCAGCAGG - Intronic
1176043919 20:63082731-63082753 CTTCCCAGAGGGCCCCCAGCAGG + Intergenic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1176704370 21:10101053-10101075 CTTCCCACAGGTCCACCAGGCGG + Intergenic
1178814840 21:35919701-35919723 GTACCCAAAGGGCCACTCTCAGG - Intronic
1179568967 21:42266837-42266859 ATTCCCTAAGTGACACCAGCAGG - Intronic
1179586611 21:42377428-42377450 ATTCCCCAAGGGCCTCCAGGAGG + Intronic
1179912412 21:44457100-44457122 GCTCCCACAGGGCCTCCTGCAGG - Exonic
1181854904 22:25774675-25774697 TTCCCCAAATGGCCACCAGGTGG + Intronic
1183562194 22:38584009-38584031 TTTGCCAAAGGACCAGCAGCTGG - Intronic
1185271135 22:49929699-49929721 GGTCCCACAGCGCCACCTGCTGG - Intergenic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
950964124 3:17134361-17134383 GATCCCAAAGGCACACCAGCGGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
954438343 3:50507946-50507968 GGTCCCCAAGGGCCCCCAGCTGG + Intergenic
954716143 3:52527866-52527888 GTTTCCCATGGGCCACCAGGCGG + Exonic
956252655 3:67251044-67251066 GTTACCAAATCTCCACCAGCTGG - Intergenic
956849092 3:73211939-73211961 CTTCCCCTAGGGCAACCAGCTGG - Intergenic
958419503 3:93914527-93914549 GTTTCCAGAGGGGCACCTGCAGG - Intronic
960204072 3:114873778-114873800 ATTCCCAAAGGGCCCCCAACAGG + Intronic
960864223 3:122184075-122184097 GTTCCCCGAGGGCCACAGGCCGG - Intronic
960994419 3:123331612-123331634 GGTGCCACAGGGCCACCTGCAGG + Intronic
961589945 3:127971473-127971495 AGTCTCAAAGGGCCAACAGCTGG - Intronic
962319116 3:134376420-134376442 GTCCCCAAAGGGACAGAAGCGGG + Intergenic
966373490 3:179272569-179272591 ATTCCCAAATGCCCACCAGGAGG - Intergenic
967294795 3:187954497-187954519 GTTCACAAAGCTCGACCAGCTGG - Intergenic
968450954 4:675698-675720 GTTCCTAACGGGCCACAAGCTGG - Intronic
969267146 4:6071854-6071876 TTTACCAAAGGGCCCCCAGCAGG + Intronic
970268609 4:14318277-14318299 GTTCTCCAAGGGCCAGCAGGTGG - Intergenic
971913699 4:32831031-32831053 GTTACCAAAGGACCACCACAGGG + Intergenic
978027605 4:103896749-103896771 GTTCCAGAAGGGCCATCTGCAGG - Intergenic
978206832 4:106089980-106090002 CTTCCCAAAGCTCCACTAGCCGG + Intronic
980376582 4:131957387-131957409 CTTCCCACAGGTCCACCAGGCGG + Intergenic
984699159 4:182807473-182807495 AATCCCAAAGGGCCACTAACGGG + Intergenic
985408180 4:189656842-189656864 TTTCCCAAAGGAAGACCAGCCGG + Intergenic
985677575 5:1240081-1240103 CTTCCCTAAAGGCCGCCAGCGGG - Intronic
986837881 5:11661826-11661848 GTTCCTAACAGGCTACCAGCCGG - Intronic
989832806 5:45941482-45941504 GTTCCCAAAAGTCCACTTGCAGG - Intergenic
992615157 5:78540526-78540548 GAACACATAGGGCCACCAGCAGG + Intronic
993968547 5:94388300-94388322 GTTCCTAACAGGCCACCAACTGG + Intronic
995433237 5:112105708-112105730 CTTCTCAGAGGGCCTCCAGCTGG + Intergenic
997608350 5:135192548-135192570 GTTCCCATGGGGCCTTCAGCTGG + Intronic
998253887 5:140570374-140570396 CTTCCTGAAGGGCCTCCAGCTGG + Intronic
999203310 5:149831653-149831675 GCTCCCAGAGGGCAAACAGCTGG - Intronic
999389413 5:151179458-151179480 GTTCTTAAATGGCCTCCAGCTGG - Intergenic
1001935601 5:175701510-175701532 CTTCCCATAGAGCCACCAGCAGG + Intergenic
1002045137 5:176537241-176537263 GTTCTTAAAGGGCCAGCCGCCGG - Exonic
1002444320 5:179279861-179279883 TTTCCAAAAGGGACGCCAGCGGG + Intronic
1002508087 5:179694455-179694477 GCCCCCAAAAGGCCACCATCTGG + Intronic
1003668228 6:8131445-8131467 GGTCCCATAGTGACACCAGCTGG - Intergenic
1004629958 6:17411794-17411816 GTCCCCTAAGGGCCACACGCTGG - Intronic
1004694516 6:18021180-18021202 GTTCCCCAACGGCCACAATCAGG - Intergenic
1004699456 6:18065391-18065413 GTTCCTAACAGGCCACCAACTGG - Intergenic
1006668852 6:35717145-35717167 ATTCCCACAGGGCCATCAGTAGG + Intronic
1007895366 6:45350872-45350894 GTTCCCAACAGGCCACGAACTGG - Intronic
1008619574 6:53258548-53258570 ATTCCCACTGTGCCACCAGCAGG + Intergenic
1008900303 6:56606598-56606620 GTTCCCCAGGGGGCACCAGTTGG - Intronic
1013501000 6:110751195-110751217 GTTCCTAACAGGCCACCAACTGG - Intronic
1014474746 6:121858477-121858499 GCCCCCAAAAGGCCACCATCTGG - Intergenic
1015880292 6:137865375-137865397 GTTTACAAAGGAGCACCAGCAGG + Intergenic
1016369903 6:143362632-143362654 GTTCTCAAAGGCCCCCCAGCGGG - Intergenic
1019296593 7:280069-280091 GATCACAAAGACCCACCAGCGGG + Intergenic
1019658007 7:2207956-2207978 GTTCTCCAGGGGTCACCAGCTGG - Intronic
1019682590 7:2359817-2359839 GTTCTCCAGGGGCCACCAGCTGG - Intronic
1020009591 7:4800743-4800765 CTGCCCTGAGGGCCACCAGCTGG + Intronic
1021155514 7:17205043-17205065 GGTTCCAAAGGGCCAGCTGCAGG - Intergenic
1022417502 7:30190734-30190756 GTGCCCAGAGGGCCCACAGCAGG + Intergenic
1023473302 7:40549067-40549089 GTTCCAAGAGGGCCATCAGAAGG - Intronic
1031918099 7:127582020-127582042 CTTGCCAGAAGGCCACCAGCTGG + Exonic
1034007991 7:147495809-147495831 GTTCCTAAAAGGCCACAAACTGG - Intronic
1035056306 7:156039017-156039039 CTGCACAAAGGGCCACAAGCTGG - Intergenic
1035231518 7:157468706-157468728 GTCTCCTGAGGGCCACCAGCAGG - Intergenic
1037798210 8:22014720-22014742 GTTCCCAAATGTTCACCAACAGG + Intergenic
1038369393 8:26972956-26972978 CTTCCCAAAGGGCCTCAAGGAGG + Intergenic
1041143294 8:54845103-54845125 GTGGCCAAAGGGCCAGAAGCTGG + Intergenic
1041502749 8:58556399-58556421 GTTCCCAATGGGCCACCGACTGG + Intronic
1043781305 8:84339250-84339272 GTTCCCAACAGGCCACAAACTGG - Intronic
1043979164 8:86618255-86618277 GTTCCCAACAGGCCACCGACTGG + Intronic
1045980861 8:108185609-108185631 GTTCCTAACAGGCCACCAACTGG + Intergenic
1045998993 8:108397018-108397040 TCTCCCAGAGGGTCACCAGCAGG + Intronic
1046883014 8:119331217-119331239 GTTCTCTAAAGGACACCAGCTGG + Intergenic
1047033596 8:120911053-120911075 GGTCCCAAAGAGCCACCATATGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049178283 8:141207023-141207045 CTTCCCAGAGGGCCGCCAGCTGG - Intergenic
1053219911 9:36303831-36303853 GCCCCCAAAAGGCCACCATCTGG - Intronic
1053641631 9:40088069-40088091 CTTCCCACAGGTCCACCAGGCGG + Intergenic
1053764504 9:41377395-41377417 CTTCCCACAGGTCCACCAGGCGG - Intergenic
1054322519 9:63685458-63685480 CTTCCCACAGGTCCACCAGGCGG + Intergenic
1054543120 9:66288572-66288594 CTTCCCACAGGTCCACCAGGCGG - Intergenic
1055325306 9:75122195-75122217 ATTTCCAAAGGGAAACCAGCAGG + Intronic
1057699979 9:97356654-97356676 ATTCCTAATGGGCCTCCAGCTGG + Intronic
1057792276 9:98132187-98132209 GGTCCCACAAGGCCACCTGCCGG + Exonic
1058844250 9:108940200-108940222 GGTTCCAAAGGGCCAACTGCAGG + Exonic
1060199814 9:121645856-121645878 TTCCCCAAAGGGCCACCTACAGG - Intronic
1060652858 9:125345070-125345092 GTTTCCACAGGGCCAACTGCAGG - Intronic
1060812716 9:126619047-126619069 GAGCCCAAAGGGCCCCCAGCGGG - Intronic
1202789407 9_KI270719v1_random:71155-71177 CTTCCCACAGGTCCACCAGGCGG + Intergenic
1185837445 X:3358258-3358280 GTTCCCAACAGGCCACCGACTGG - Intergenic
1186237800 X:7532245-7532267 GTTCCTAACAGGCCACGAGCCGG + Intergenic
1188412532 X:29891370-29891392 TTTTCCAAATGGCCATCAGCAGG + Intronic
1191772405 X:64775205-64775227 CTTCCCAGAGGGGCACCTGCTGG - Intergenic
1192194295 X:69018358-69018380 GTTCCCTGAGGGCCACTACCAGG - Intergenic
1194448719 X:94016409-94016431 CTTCCCAGAGGGCTCCCAGCGGG + Intergenic
1195493250 X:105498847-105498869 GTTCCCAAAAGGCCACAGACTGG - Intronic
1199609534 X:149600928-149600950 GTTGCCAAAGTACCCCCAGCAGG - Intronic
1199629582 X:149768426-149768448 GTTGCCAAAGTACCCCCAGCAGG + Intergenic