ID: 950882483

View in Genome Browser
Species Human (GRCh38)
Location 3:16334551-16334573
Sequence CAGCTCAGAGAACTGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950882478_950882483 23 Left 950882478 3:16334505-16334527 CCATCAGTGCTGGATTTGTATTT 0: 1
1: 0
2: 4
3: 15
4: 273
Right 950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG 0: 1
1: 0
2: 0
3: 29
4: 326
950882477_950882483 24 Left 950882477 3:16334504-16334526 CCCATCAGTGCTGGATTTGTATT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG 0: 1
1: 0
2: 0
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950882483 Original CRISPR CAGCTCAGAGAACTGGGCAA TGG Intronic
900541984 1:3207523-3207545 GAGGCCAGAGAACTGGGCAAAGG - Intronic
901188360 1:7389236-7389258 GAGCCCAGAGAGCTGGCCAAGGG - Intronic
902166061 1:14572493-14572515 CAGATCAGAGATCTGGGGACAGG - Intergenic
902253794 1:15174129-15174151 CAGCTGTCAGCACTGGGCAAAGG + Intronic
902684355 1:18066382-18066404 CAATACAGAGAACTGGACAATGG + Intergenic
903798189 1:25946143-25946165 AGGCTCAGAGAACTGGGCCCTGG + Intergenic
905253410 1:36664724-36664746 GGGGTCAGAGAACAGGGCAATGG - Intergenic
905946784 1:41907836-41907858 CAACTCAGACACATGGGCAATGG + Intronic
906871233 1:49483671-49483693 CAGGACATAGAACTGGGCAAAGG + Intronic
907824690 1:58004090-58004112 GAGCTCAGAGAAATAGGCAGAGG + Intronic
910763856 1:90761462-90761484 CAGCTCAGGGCAGTGGCCAAAGG - Intergenic
911411602 1:97516292-97516314 GTGCTCAGAGATATGGGCAACGG + Intronic
914242204 1:145859396-145859418 GAGCTCAGAGAAATGGGGGAGGG + Intronic
915437541 1:155919942-155919964 CAGGTAAGGGGACTGGGCAATGG + Intronic
917018176 1:170558177-170558199 CAGGTGAGAGAACTGGGGAATGG + Intergenic
918340861 1:183567059-183567081 CAGCCCAGAGTCCTGGGGAAGGG + Intronic
920376840 1:205513331-205513353 CAGATCAGAGACCAGAGCAAGGG - Intronic
921110729 1:212034390-212034412 CAACTCAGAAAACTGGGAAGTGG + Intronic
921160712 1:212470388-212470410 GAGCTGAGAGAACTGGAGAATGG + Intergenic
922467430 1:225853801-225853823 CAGCTCACAGACCTGGGCCCTGG - Intronic
922989003 1:229889194-229889216 CAGGTCTGGAAACTGGGCAAGGG - Intergenic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
923641615 1:235767396-235767418 CAGCTATGAGAACTTGGCAAAGG - Intronic
923877602 1:238066310-238066332 CAGCTCAGAAAAATGAGGAAAGG + Intergenic
923895581 1:238266586-238266608 CAGCCTAGAGAACTGAGAAAAGG - Intergenic
924625093 1:245690650-245690672 CAGATCACAGAACTTGGCCATGG + Intronic
1063838651 10:10045532-10045554 CTTCCCAGAGAGCTGGGCAAGGG + Intergenic
1064693219 10:17939266-17939288 CAGTTCAGAGAAATGGAGAACGG + Intergenic
1065352703 10:24809844-24809866 CAGCAGAGAAAACTGTGCAATGG + Intergenic
1066279478 10:33901287-33901309 CAGCTCTGAGAAGTGGGCTCAGG + Intergenic
1068136124 10:52952549-52952571 CATCACAGAGCACTGGCCAAGGG - Intergenic
1069464777 10:68628658-68628680 CATCTCTAAGAACTGGACAAAGG - Intronic
1069992432 10:72323727-72323749 CTGCTCAGAGAAGTGGACAGAGG + Intergenic
1070329580 10:75407987-75408009 GAGGACAGAGAACTGGGCAGGGG - Intergenic
1070816569 10:79328283-79328305 CAGCTCAGAGGCCATGGCAAGGG - Intergenic
1072796697 10:98361520-98361542 CTGCTCAGAGAGCTGGGGTAAGG + Intergenic
1073459040 10:103655035-103655057 CAGCTCTGTGAAGTGGGTAACGG + Intronic
1073740557 10:106401252-106401274 GAGGTCAGAGAACTGGTCACAGG + Intergenic
1074162596 10:110846603-110846625 CAGCTCAGAGAGGTGGGAACTGG + Intergenic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1075312420 10:121425701-121425723 CAGCTCTCCAAACTGGGCAAAGG - Intergenic
1077093197 11:788736-788758 GAGTCCAGAGAACTGGGCAGGGG - Intronic
1077325801 11:1963514-1963536 GAACTCAGAGGACTGTGCAAAGG - Intronic
1078035041 11:7794698-7794720 CTGGTCAAAGAACTGGGAAAAGG - Intergenic
1078036425 11:7810273-7810295 CTTCTGAGAGAACAGGGCAAAGG + Intergenic
1078579727 11:12529000-12529022 CACCGCAGAGAGCTGGGCACGGG + Exonic
1078753374 11:14186300-14186322 CAGCTCTAACAAGTGGGCAAGGG + Intronic
1079131401 11:17748906-17748928 CAGCTCAGAGAACCGTGTATGGG - Intronic
1079704557 11:23597977-23597999 CAGCTCAGGGAAATGGCCCAAGG + Intergenic
1079798413 11:24837117-24837139 AATGTCAGAGAACTGGGGAAAGG - Intronic
1083839927 11:65298512-65298534 CAGGGCAGGGAAGTGGGCAAGGG + Exonic
1084013196 11:66364036-66364058 CAGGGGAGAGAACTGGGCTAGGG - Intronic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1087981567 11:104620392-104620414 GAACTCAGAGACCTGGGAAAGGG + Intergenic
1088266324 11:107991296-107991318 CAGTTCTGAAAACCGGGCAAGGG + Intergenic
1089057837 11:115601060-115601082 CTGGGCAGAGAACTGTGCAAAGG - Intergenic
1089681202 11:120119906-120119928 CCCCTCAGAGCACTGGGCAGAGG + Intronic
1089926792 11:122267241-122267263 CAGCTGAGGCAACTGAGCAATGG - Intergenic
1090262687 11:125332836-125332858 CTGCTTGGAGAGCTGGGCAAAGG - Intronic
1090548317 11:127790575-127790597 CAACTCAGAGAACAGGATAAAGG + Intergenic
1202808781 11_KI270721v1_random:18693-18715 GAACTCAGAGGACTGTGCAAAGG - Intergenic
1091624113 12:2109541-2109563 GAACTCAGAGAAGTGGGCCAGGG + Intronic
1091807774 12:3367920-3367942 CAGCTCAGCAACCTGGGCACAGG + Intergenic
1091919131 12:4290228-4290250 CAGCTCAGAGAAATGGCGCAGGG + Intronic
1092095874 12:5841587-5841609 CAGCTCAGAGAGAGGGGCAGGGG - Intronic
1092681850 12:10992092-10992114 CAGTCCAGAGAACTGGCTAAGGG - Intronic
1096070309 12:48771788-48771810 GAACTCAGAGAAGTTGGCAATGG + Exonic
1097680501 12:62644704-62644726 CTGCTCAGAGAGGTGGGCTATGG + Exonic
1099947679 12:89263500-89263522 CATCTCTGAGAACTGGGAATTGG - Intergenic
1100224279 12:92540552-92540574 CAGCTCAGACATGAGGGCAAAGG + Intergenic
1101364163 12:104056082-104056104 CAGAACAGGGAACTGGGCCAAGG - Intronic
1102443108 12:112978597-112978619 CAGCTGAGAGCAATGGGAAATGG + Exonic
1102569961 12:113821432-113821454 CAGCTCACAGATCTGAGCAGTGG + Intronic
1103205306 12:119124316-119124338 GAGGCCAGAGAACTAGGCAAGGG + Intronic
1103518952 12:121525028-121525050 GAGGTCTCAGAACTGGGCAAGGG + Intronic
1104034823 12:125091084-125091106 CAGATCAGACAGCTGTGCAAAGG + Intronic
1107942307 13:45385698-45385720 CAGCTCCCAGAACTGGGGGAAGG + Intergenic
1108167552 13:47709238-47709260 GAGCTCTCAGACCTGGGCAAGGG + Intergenic
1108173846 13:47772512-47772534 AAGGGCACAGAACTGGGCAAAGG - Intergenic
1108517527 13:51217125-51217147 CAGTTCAGAAAGCTGTGCAATGG - Intergenic
1109741783 13:66563218-66563240 CTGTTTAGAGAACTGGGAAATGG - Intronic
1110443933 13:75555561-75555583 CTGCTCATTGAACTAGGCAAAGG - Intronic
1111610287 13:90596716-90596738 CAGATCAGAGAACAAAGCAAAGG - Intergenic
1112020078 13:95363855-95363877 CAGCTCATGGAAGTGTGCAAGGG + Intergenic
1112302530 13:98242938-98242960 TAGCTCAGAGAAAGGGGAAAAGG + Intronic
1112737563 13:102438367-102438389 CCCCTCAGAGAGCTGAGCAAAGG - Intergenic
1113614789 13:111672264-111672286 CAGCTCAGAGGTCAGGACAAGGG + Intronic
1113620258 13:111757178-111757200 CAGCTCAGAGGTCAGGACAAGGG + Intergenic
1114460871 14:22885374-22885396 AAGCTGGGAGAACTGGGGAAGGG + Intronic
1116047245 14:39759439-39759461 CATATCAGAGAACTGGGAAAGGG - Intergenic
1116171562 14:41408572-41408594 CAGTTCAGAAAAGTGGGTAAGGG + Intergenic
1118476720 14:66124309-66124331 CAGTTCTGAGATCTGAGCAATGG - Intergenic
1118909849 14:70052172-70052194 CAGCTCAGAGTATTAGGCATGGG + Intronic
1119725039 14:76917181-76917203 CAGCTCAGAGACCTCTGCTAGGG + Intergenic
1120799298 14:88670540-88670562 AAGGGCACAGAACTGGGCAAAGG + Intronic
1121250049 14:92492742-92492764 AAGGTCACAGAATTGGGCAATGG + Intronic
1121438167 14:93932413-93932435 CAGCCCAGAGACCCGGGCACTGG - Intergenic
1122302795 14:100740652-100740674 TAGCCCAGAGCACTGTGCAAAGG - Intergenic
1122617698 14:103031660-103031682 CTGCTGAGAGCACTGGGGAAAGG - Intronic
1122716631 14:103700221-103700243 CAGCTCAGAGCACAGGGCTAAGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126317981 15:47391207-47391229 CAGCTCAGAGAGCAGAGGAAAGG - Intronic
1126901615 15:53320104-53320126 CAGCTTAGAGAACTAGGGTAAGG + Intergenic
1127138772 15:55952699-55952721 AAGTTCAGAGAACTGAACAAGGG - Intronic
1127274502 15:57430563-57430585 CAGTTAAGAGAAGTGGGCAAGGG + Intronic
1127405540 15:58641102-58641124 CAGCTCAGGGATGTGGGCAGTGG - Intronic
1129520680 15:76184058-76184080 CAGCTCAGAAAAGGGGCCAAAGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130295755 15:82646550-82646572 CAGCTGAGAGCACGGTGCAAGGG + Intronic
1132625971 16:891682-891704 CAGGTCAGAAAAGTGGGCAGGGG - Intronic
1133323935 16:4931917-4931939 CTTCCAAGAGAACTGGGCAAGGG + Intronic
1133605632 16:7385112-7385134 GAGGTCTGAGAATTGGGCAAAGG + Intronic
1133814461 16:9185785-9185807 CAAGACAGAGAAATGGGCAAAGG + Intergenic
1134091375 16:11393349-11393371 CAGCTCAGCTAGCTGGGCCACGG - Intronic
1134501236 16:14770705-14770727 CAACACAGGGAACTGGACAAAGG - Intronic
1134579344 16:15358329-15358351 CAACACAGGGAACTGGACAAAGG + Intergenic
1134723238 16:16399225-16399247 CAACACAGGGAACTGGACAAAGG - Intergenic
1134944190 16:18312645-18312667 CAACACAGGGAACTGGACAAAGG + Intergenic
1135004192 16:18803410-18803432 CCCCTAAGAGAGCTGGGCAAGGG + Intergenic
1135772659 16:25229051-25229073 CAGCTCAGAGTCCTGGGCCATGG + Intergenic
1137604803 16:49780334-49780356 CTCCTCAGAGAACTGGTCCAAGG + Intronic
1138517199 16:57542732-57542754 AAGGACAGAGAACTGGGCAGAGG - Exonic
1139631407 16:68234096-68234118 CAGCTGTGAGAACTGGGGATAGG + Exonic
1139736223 16:68991186-68991208 CAGCTCTGAGAGCTGAGCAGAGG + Intronic
1140148579 16:72337881-72337903 CAGCCCAGAGAACAGGGAAGTGG + Intergenic
1140384661 16:74524864-74524886 GAACTCAGAGAAGTGGGGAATGG - Intronic
1140473560 16:75227722-75227744 CAGCTCAGAGGGCTGGGAAGAGG - Intergenic
1140703213 16:77601777-77601799 CACCTCATATAACAGGGCAAGGG + Intergenic
1141238182 16:82240082-82240104 CACGTCAGAGACATGGGCAAAGG + Intergenic
1142407464 16:89898734-89898756 CAGCACAGAGAGCAGAGCAAAGG - Intronic
1142470434 17:160552-160574 CCCCTAAGAGGACTGGGCAAGGG - Intronic
1142807215 17:2377636-2377658 CAGCTCAGAGAGATGGGTGATGG + Intronic
1144962826 17:19055607-19055629 GAGCTCAGAGAAGAGGTCAAAGG - Intergenic
1144972335 17:19118914-19118936 GAGCTCAGAGAAGAGGTCAAAGG + Intergenic
1145190529 17:20839992-20840014 CAGTTCACAGTACTGGGCAATGG - Intronic
1145401743 17:22543828-22543850 CAGTTCACAATACTGGGCAATGG - Intergenic
1147166135 17:38594445-38594467 CAGTTCAGAGAGCTGGAAAAGGG + Intronic
1147557905 17:41491192-41491214 CAGGTCACAGAAATGGCCAATGG + Intronic
1149560656 17:57605751-57605773 CAGCTGAAAGAAGAGGGCAAAGG - Intronic
1150388678 17:64778920-64778942 CAGCACAGAGCACTGAGCATTGG - Intergenic
1151829978 17:76543792-76543814 GAGCTCTGGGAACTGGGGAAAGG - Intronic
1151971310 17:77458908-77458930 CAGCTCAGATATAGGGGCAACGG + Intronic
1152923301 17:83076602-83076624 CAGCTAAGGGACCTGGGCCAGGG - Intergenic
1153099525 18:1450945-1450967 CATCTCTGAGCACTGGGGAAGGG + Intergenic
1153576131 18:6523740-6523762 TAGCTCAGAGAACCCGTCAAAGG + Intronic
1153590800 18:6672476-6672498 CAGCTCTGGAAACTGGGCAAGGG + Intergenic
1153956544 18:10101358-10101380 CAGCTCTGAGAGCTGTGCCAGGG - Intergenic
1155287984 18:24310955-24310977 CAGATCAGTGAACTTTGCAAAGG - Intronic
1155596700 18:27496191-27496213 GAGGACAGAGAGCTGGGCAAGGG + Intergenic
1157478903 18:48040289-48040311 CTGCTCAGGCAGCTGGGCAAAGG + Exonic
1158012819 18:52748463-52748485 CAGCACAGTGAACGGGGCAAGGG + Intronic
1158498034 18:57974258-57974280 CAACTCTGAGAACAGAGCAAGGG - Intergenic
1158520131 18:58165051-58165073 CAGCTTAGAGAACTAGATAAGGG - Intronic
1159732511 18:72047607-72047629 CAGCTCAAAGAACTAGAAAAAGG + Intergenic
1162585016 19:11553185-11553207 CAGCCCAGGGACCTGGGGAACGG + Exonic
1164748696 19:30635415-30635437 CAATTCACAGAACTGGGCACTGG + Intronic
1166664378 19:44669970-44669992 CAGCACACACAACTGGGCACTGG + Intronic
1166763875 19:45241110-45241132 CAGGGCAGGGAAGTGGGCAAGGG - Intronic
1167093021 19:47357801-47357823 CAGCTCAGAGCAATGGGCTGGGG - Intronic
1167891294 19:52541820-52541842 CAGCTGAGACAACTGGACACAGG - Intronic
925952437 2:8927691-8927713 CAGCCAGGAGAACTGGGGAAGGG + Intronic
927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG + Intronic
927759255 2:25737196-25737218 CTTCTGAGAGAACTGGGAAACGG + Intronic
927921763 2:26977873-26977895 CAGCTCTGAGCACTGAGAAAGGG + Intronic
928139096 2:28712298-28712320 CAGCACAGAGTACTAGGCATAGG - Intergenic
928543797 2:32310082-32310104 CAGTGCAGAGAATTGGGTAAGGG - Exonic
929600356 2:43200651-43200673 CAGCACAGAAAGCTGGGCAAGGG - Intergenic
930910818 2:56627368-56627390 CAGCTCACTGAAATGGGAAAAGG - Intergenic
931110522 2:59105807-59105829 CAGCTAATAGAATTAGGCAAAGG + Intergenic
935155407 2:100479806-100479828 AAGCTCTGAGAAATGGACAACGG - Intronic
935183024 2:100706925-100706947 CAGCTCCGAGCGCTGGGCAGGGG + Intergenic
935344415 2:102092650-102092672 AAACTCCGAGAACAGGGCAAAGG + Intronic
935782128 2:106517590-106517612 AACCCCAGAGAACTGGGGAAGGG - Intergenic
935921402 2:108019350-108019372 CAGCTCATAGAAGTAGGCCAGGG + Intergenic
936147318 2:109988641-109988663 CAGATCAGGGAAATGGGCAGTGG - Intergenic
936197374 2:110382843-110382865 CAGATCAGGGAAATGGGCAGTGG + Intergenic
938797905 2:134734280-134734302 CAGCTCTGGGAACATGGCAATGG - Intergenic
939174592 2:138734917-138734939 CAAATCAGAAAACTGGTCAAGGG + Intronic
940007235 2:149019206-149019228 CAGCTAAGAAAACTGTGGAATGG + Intronic
940825811 2:158411016-158411038 CAGCTCAGAGAAAAGTGCGATGG - Intronic
941741304 2:169038380-169038402 CAGCTAAGAAAACTGAGAAAAGG + Intergenic
942495495 2:176535567-176535589 CTGCTCAGAGAACATGGCCAGGG + Intergenic
942581973 2:177429328-177429350 AAGGGCAGAGAACTGGGCTAAGG - Intronic
942957154 2:181786987-181787009 CTGCTCTCAGAACTGGGCAAAGG + Intergenic
943858464 2:192828662-192828684 CAGCTCAGAGAGATCGGCAGCGG - Intergenic
944599149 2:201285440-201285462 CAGGTCAGAGAACTGTCCAAGGG + Intronic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
947502675 2:230682954-230682976 GAGCTGAGAGAACTGGGAACGGG + Intergenic
948124129 2:235552462-235552484 CAGTGCAGAGCACTGGGAAATGG + Intronic
948134240 2:235624298-235624320 CAGAACAGAGAAGGGGGCAAGGG - Intronic
948352382 2:237351334-237351356 CAGCTCTGAGCACGGGGCTACGG + Intronic
948759825 2:240183672-240183694 CAGGGCAGAGAGGTGGGCAAGGG - Intergenic
948829091 2:240588892-240588914 AAGCTCAGAGGGGTGGGCAAGGG + Intronic
1168805403 20:669760-669782 CTGCTCACAGAGCTGGGCAAAGG + Intronic
1168888423 20:1276371-1276393 CCACTCAGAGAGCAGGGCAAGGG - Intronic
1169252875 20:4073582-4073604 CAGCTCATAGAAATAGGAAAGGG - Intronic
1170392813 20:15893853-15893875 AAGGTGAGAGAAATGGGCAATGG + Intronic
1171947938 20:31395242-31395264 CAGCTAGGAGATCTGGGCCAAGG + Intergenic
1172662322 20:36575645-36575667 CAGCCCAGAGATCTGGGCTCGGG + Intronic
1172951857 20:38727400-38727422 ACGCTCAGCGAACTTGGCAACGG - Intronic
1173562950 20:44019430-44019452 CAGCTCAGAGGCCTGGGCCAAGG - Intronic
1173598152 20:44273362-44273384 CAGATCAGAGAACAGGCCCAGGG - Intronic
1173903319 20:46606914-46606936 CAGGGCACAGAACTGAGCAAAGG + Intronic
1174049702 20:47759076-47759098 CAGATCACAGCACTGGGCAGGGG + Intronic
1174564733 20:51456676-51456698 AAGCCCAGAGAACTGGGCAGAGG + Intronic
1175543595 20:59763610-59763632 GAGCTCAGAGAAATGGTCCAGGG + Intronic
1176213104 20:63935016-63935038 CAGCTCTGAATACTGGGAAAGGG - Exonic
1178921459 21:36741605-36741627 CACCTCTGAGAACTTGACAAAGG - Intronic
1180660571 22:17463437-17463459 AAGCTCAGACAAATGGGCCATGG + Intronic
1181770231 22:25119876-25119898 GAGCTCAGAGAGGTGGGCCAGGG + Intronic
1181794864 22:25299751-25299773 CAAGTCAGAGAAATGGGGAAAGG - Intergenic
1182252021 22:29008275-29008297 CATTTCAGAGCACTGGGCCATGG + Intronic
1182547193 22:31083170-31083192 CAGCTCAGAGAATTCTGCAGGGG - Exonic
1183002393 22:34872176-34872198 CAGTCTAGAGAGCTGGGCAAAGG - Intergenic
1184776376 22:46625575-46625597 CAGCTCAGAAAGCTGGTCAGTGG + Intronic
949385747 3:3500602-3500624 CACCTCAGAGAGGTGGGCAGAGG + Intergenic
949439525 3:4065829-4065851 CAGCTCTGAGAACTCAGAAAGGG + Intronic
950148190 3:10666671-10666693 AAGCCCAGAGAACAGGCCAATGG + Intronic
950667505 3:14506229-14506251 CAACTCAGAGGACTGGGTAGGGG - Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
951690405 3:25389595-25389617 CAGCGCAGAGAACTGGGTGTTGG + Intronic
952715834 3:36479894-36479916 CAGCTCAGAGAATAGTTCAAAGG - Intronic
953032091 3:39185870-39185892 CAGGTCAGAGTACTGGGCCAGGG - Exonic
953414850 3:42709719-42709741 CACATCGGAGAGCTGGGCAAAGG + Exonic
953734066 3:45476336-45476358 CAGCTCTGACCACTGGGCCAGGG - Intronic
954617127 3:51974868-51974890 CAGGCCAGAGAACTGAGCCAGGG + Intronic
954656226 3:52195880-52195902 CAGCCCAAATAGCTGGGCAACGG - Intergenic
955228367 3:57079081-57079103 CAGCTCGGGGACCAGGGCAAAGG + Intronic
958614084 3:96468050-96468072 CAGCGCACAGAACTTGGGAAAGG - Intergenic
960612732 3:119569897-119569919 CAGCTCAGAGAACAGAGGAATGG + Intergenic
961061814 3:123834955-123834977 CTGGACAGAGAGCTGGGCAATGG + Intronic
962459678 3:135598194-135598216 AGGCCCAGGGAACTGGGCAAAGG - Intergenic
963241787 3:143010682-143010704 CAGCTAATAAAACTGAGCAAAGG - Intronic
963953551 3:151228531-151228553 AAGCTCAGAGCACTCTGCAAAGG - Intronic
965468422 3:169060846-169060868 CAGATCTGGAAACTGGGCAAGGG + Intergenic
965663343 3:171065297-171065319 CAGGTCAGAGTAGTGGGCCAGGG + Intronic
966315741 3:178643827-178643849 CAGCTCTGAGAACTGGGAAGTGG - Intronic
966691537 3:182746743-182746765 GACCTCAAAGAACTGTGCAAAGG + Intergenic
967135789 3:186511653-186511675 CAGCACTGAGAACAGGGCCAGGG - Intergenic
967964899 3:194953387-194953409 CAGCCCAGAGAGCTGCACAAGGG + Intergenic
968492715 4:898942-898964 CAGCTCTGATAACAGGGCATGGG + Intronic
968702465 4:2063428-2063450 CTGCTCAGAGTAGTGGTCAAAGG - Intronic
969285301 4:6199228-6199250 GAGCTCAGAGAGCCGGGCAGAGG + Intronic
969976346 4:11105910-11105932 CTGCCCAGTGAACTGGGTAAAGG - Intergenic
970656443 4:18235535-18235557 CAGATCTGAAAACTGGGCAAAGG - Intergenic
971452060 4:26809663-26809685 CAGCTGAGACCGCTGGGCAATGG + Intergenic
972457328 4:39267377-39267399 CAGCTCAGTTAACTTGCCAAAGG + Intronic
972629390 4:40830029-40830051 CACCCCAGAAAACTGGGAAAAGG - Intronic
972635190 4:40877892-40877914 CAGCTCAGGGTACAGGGCATGGG + Intronic
973057741 4:45681211-45681233 CACATCTGAAAACTGGGCAAGGG - Intergenic
975831530 4:78373993-78374015 CAGCCTAGTGTACTGGGCAAAGG - Intronic
976052764 4:81028776-81028798 CAGCTGACAGAACTGAGAAAGGG + Intergenic
976311245 4:83615398-83615420 CAGCTCCGCAAACTGGGCTAAGG + Intergenic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
984473024 4:180201110-180201132 TAGCTCAGAGAAGTGGGAAGTGG - Intergenic
985583138 5:710752-710774 GAGCTCACAGCACTGGGAAATGG - Intronic
985583149 5:710817-710839 GAGCTCACAGTACTGGGAAATGG - Intronic
985583153 5:710840-710862 GAGCTCACAGTACTGGGAAATGG - Intronic
985583169 5:710926-710948 GAGCTCACAGCACTGGGAAATGG - Intronic
985583179 5:710990-711012 GAGCTCACAGTACTGGGAAATGG - Intronic
985583193 5:711076-711098 GAGCTCACAGCACTGGGAAATGG - Intronic
985583251 5:711359-711381 GAGCTCACAGCACTGGGAAATGG - Intronic
985615315 5:916619-916641 CAGCTCTGGGCACTGGGCCATGG + Intronic
986410596 5:7475119-7475141 CAGCTGTCAGAACTGGCCAATGG - Intronic
989516136 5:42346333-42346355 AAGCTCAGTGGAGTGGGCAATGG + Intergenic
989700644 5:44260496-44260518 GATCTCATAGAACTGGGAAAAGG + Intergenic
996563593 5:124856883-124856905 CAACTCTGAGAACTGATCAAGGG - Intergenic
997405097 5:133639517-133639539 AAGCTCTGAGGACAGGGCAAGGG - Intergenic
997840511 5:137235229-137235251 CAGGTCAGAGGACTTGGCCATGG - Intronic
997944209 5:138184592-138184614 CAGCTTAGAGAAAGGGGCTAAGG + Exonic
998028937 5:138846951-138846973 CAGCTCTGAGAACTATGAAAAGG + Intronic
998183556 5:139962001-139962023 CAGCACAGAGAGCTGGTCATTGG + Intronic
998295306 5:140964508-140964530 CAGCTCAGAGACCTGGCCACTGG - Intronic
998918169 5:147039056-147039078 AAGCACAGAGGACTGGACAAAGG - Intronic
998987784 5:147781281-147781303 CATCTGAGAGAACTGTGAAATGG + Intronic
999133290 5:149300543-149300565 CAGCTCAGAGACTTGAGGAATGG + Intronic
999177367 5:149640759-149640781 CAGCATTGAGAACTGGGCACAGG + Intergenic
1000296160 5:159915589-159915611 GAGGTCAGAGACCTGGGGAAGGG - Intergenic
1000574325 5:162957514-162957536 CAGATCAGAGAAATGAGGAATGG - Intergenic
1001159815 5:169302830-169302852 CAGATGAGAGAACCGGGCAAGGG + Intergenic
1003053931 6:2802640-2802662 CAGCTCAGAGAGCCTGACAAAGG + Intergenic
1003517984 6:6833684-6833706 CACATCAGAGAAATGGGGAAGGG + Intergenic
1005084676 6:21992819-21992841 CAGCCCAGAGAAGTAGGCTAGGG - Intergenic
1005907445 6:30276605-30276627 CAGGTCTGGAAACTGGGCAAGGG - Intergenic
1009286806 6:61828688-61828710 CACATCAAAGAACAGGGCAAGGG - Intronic
1010404016 6:75482065-75482087 GAGCTCAGAGAAGAGGACAAGGG - Intronic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1013089988 6:106891757-106891779 CAGCCCAGAGAAGTTGGTAAGGG - Intergenic
1013357528 6:109359713-109359735 CAGTTCAGACAAGTGGCCAAAGG - Intergenic
1013491924 6:110655842-110655864 CAGCTCAGGAAACTGGACACAGG + Intronic
1013842159 6:114409575-114409597 TAGCTCAGTGAACTGCGCAATGG + Intergenic
1015401488 6:132793241-132793263 TAGCTAAGCTAACTGGGCAAAGG - Intronic
1016139572 6:140592639-140592661 CAAATCAGAGAACAGTGCAAAGG - Intergenic
1016417193 6:143845157-143845179 TAGCTCAGGGAACTTTGCAAGGG + Intronic
1018614599 6:165674844-165674866 CAGCTTTAAGAACTGGGGAAGGG - Intronic
1020528781 7:9301571-9301593 CAGTGCTGAGAACTGGGTAAAGG - Intergenic
1021150826 7:17148831-17148853 CAGCTCTGAAAACTATGCAAGGG + Intergenic
1022172192 7:27841061-27841083 CACCTAAGAGACCAGGGCAAGGG + Intronic
1022404031 7:30069887-30069909 CATCTCAAAGAACTGGGAGAAGG + Intronic
1022892889 7:34719081-34719103 CAGCTGAGAGAAGTGGGGGATGG + Intronic
1023301911 7:38782254-38782276 CTGCTCTGAGAACTGGGCCCAGG - Intronic
1024053013 7:45641334-45641356 CAGCTCACAGAACTGGGGTATGG - Intronic
1024336972 7:48218614-48218636 GAGCCCAGAGAACTGAGCACTGG - Intronic
1025944149 7:66093347-66093369 AAGCGGAGAAAACTGGGCAAGGG + Exonic
1026445540 7:70481554-70481576 CAGCTCAGTTAAATGGGCCAGGG - Intronic
1026506049 7:70984899-70984921 CAAGTCACAGAACTGGTCAATGG + Intergenic
1026635819 7:72080740-72080762 TAGGTCAGAGAACTGGGCAGAGG + Intronic
1026950079 7:74340988-74341010 CTGCTCTGAGAACCTGGCAAAGG + Intronic
1026975337 7:74494425-74494447 CAGCTCAGAGTCCAGGGCAAGGG + Intronic
1027234416 7:76289592-76289614 CAGCTCTGGGGACTGGGCCAAGG - Intergenic
1028441986 7:90874120-90874142 CAGCTCAGGGAAGAGGGGAAGGG - Intronic
1029273090 7:99388527-99388549 CAGCTCCGTGGACTGGGCATCGG + Intronic
1029483389 7:100825906-100825928 CAGCTCAGAGAACGGAGAAGGGG - Intronic
1029536241 7:101159470-101159492 TTGCTCAGAGAATTGGACAAAGG - Intronic
1031269134 7:119622791-119622813 CCTTTCATAGAACTGGGCAAAGG + Intergenic
1032079091 7:128849772-128849794 CAGCTGACAGCACTGGGCAGGGG - Intronic
1035700932 8:1638929-1638951 CAGCCCAGAGAGCTGGGTCATGG + Intronic
1037292812 8:17369056-17369078 TAGCCCAGCGAACTGGGAAAGGG - Intronic
1038345581 8:26729192-26729214 CAGCTCAGAGAAGAAGGCAGTGG + Intergenic
1042684061 8:71417993-71418015 CAGCTCAGAGAAGGGTACAAAGG - Intronic
1042693730 8:71532384-71532406 CAGCTCAGAGCTCTGGGCTGAGG - Intronic
1043805071 8:84661880-84661902 CAGCTCAAAGAAATGTGAAAAGG - Intronic
1045550018 8:103163265-103163287 AAGAGAAGAGAACTGGGCAAGGG - Intronic
1046097490 8:109578672-109578694 CAGCTCAGGCACCTGGACAATGG - Intronic
1047340569 8:123976650-123976672 CAGCTCAGAGAAGTAGCCAGGGG - Intronic
1048305807 8:133283951-133283973 AGGCCCAGAGAAGTGGGCAAGGG + Intronic
1049057820 8:140252865-140252887 CTGCAAAGGGAACTGGGCAAGGG + Exonic
1049259110 8:141629360-141629382 GAGCTCGGAGGAGTGGGCAAAGG + Intergenic
1049976980 9:869380-869402 CAGCTAGGAGAACTGGCAAATGG - Intronic
1051728760 9:20116015-20116037 CAGTTCATAGAAATGGACAATGG - Intergenic
1053440074 9:38108826-38108848 CAGCTCTGAGATCTGAGGAAGGG + Intergenic
1053786180 9:41654452-41654474 CAGCGAAGAGAGGTGGGCAAGGG + Intergenic
1054158869 9:61659746-61659768 CAGCGAAGAGAGGTGGGCAAGGG - Exonic
1054449754 9:65397445-65397467 CAGCGAAGAGAGGTGGGCAAGGG + Intergenic
1054478643 9:65590751-65590773 CAGCGAAGAGAGGTGGGCAAGGG - Intergenic
1054767902 9:69057808-69057830 AACCTCAGAGTGCTGGGCAAGGG - Intronic
1056404049 9:86257465-86257487 CAGCTGAGAGAACTGAAAAAGGG - Intronic
1057458236 9:95234121-95234143 AACCTAAGAGAACTGGGAAATGG + Intronic
1058437351 9:104975286-104975308 AAACTCAGAGAGCTGGGAAAGGG + Intergenic
1058553153 9:106137174-106137196 CACAGAAGAGAACTGGGCAATGG - Intergenic
1060047748 9:120354020-120354042 CAGCTGAGAGCACAGGGCAGAGG + Intergenic
1060474363 9:123975844-123975866 CAGCTCTGGGCACTGGGCACTGG + Intergenic
1061261836 9:129484432-129484454 CAGCCCTGAGAACAAGGCAAGGG - Intergenic
1062569197 9:137176971-137176993 CAGCTCTGAGACGTGGCCAAGGG + Intronic
1190684319 X:52857265-52857287 TAGCTCAGAGAAGTGGCTAATGG + Intergenic
1191000181 X:55651692-55651714 TAGCTCAGAGAAGTGGCTAATGG + Intergenic
1192244098 X:69358933-69358955 CTGCTCTGAGCACTGGACAAAGG + Intergenic
1192261871 X:69510474-69510496 GAGCTCAGGGCACTGGGTAAAGG + Intronic
1194268694 X:91783072-91783094 CAGGTGAGAGATGTGGGCAAAGG + Intronic
1195945775 X:110209783-110209805 AAGCTCACAGAGCTGGGCAGTGG + Intronic
1195958345 X:110358788-110358810 AAGCTCAGAGGACTGGGCTCTGG + Intronic
1196692101 X:118571014-118571036 CAGCTAACAGAGCTGGGCAATGG - Intronic
1199237398 X:145507026-145507048 CAGTGCAGAGAAGTGGTCAATGG + Intergenic
1200287669 X:154839021-154839043 CAGATCAGAGACTTGGGCAGGGG - Intronic
1200585896 Y:5003988-5004010 CAGGTGAGAGATGTGGGCAAAGG + Intronic
1201178838 Y:11327036-11327058 CACCTCAGAGAACAGTGCATAGG + Intergenic