ID: 950885287

View in Genome Browser
Species Human (GRCh38)
Location 3:16357276-16357298
Sequence AGCTACCCACTAGTGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950885284_950885287 0 Left 950885284 3:16357253-16357275 CCGCAGTTAGAGAAATGCCCTTC 0: 1
1: 0
2: 0
3: 21
4: 134
Right 950885287 3:16357276-16357298 AGCTACCCACTAGTGAATCTTGG 0: 1
1: 0
2: 0
3: 6
4: 58
950885283_950885287 8 Left 950885283 3:16357245-16357267 CCATGCTTCCGCAGTTAGAGAAA 0: 1
1: 0
2: 0
3: 9
4: 144
Right 950885287 3:16357276-16357298 AGCTACCCACTAGTGAATCTTGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950885287 Original CRISPR AGCTACCCACTAGTGAATCT TGG Intronic
908303653 1:62788347-62788369 TGTTAACAACTAGTGAATCTAGG - Intronic
910918447 1:92317136-92317158 AGCTAACAAGTAGTAAATCTAGG - Intronic
912880507 1:113407703-113407725 AGCTAGTTACTGGTGAATCTAGG + Intronic
921627991 1:217399764-217399786 AACTACCCACTTTGGAATCTTGG + Intergenic
922215872 1:223519674-223519696 AGCTGCCCTCAAGTGACTCTTGG - Intergenic
924587059 1:245369235-245369257 ACCTTCCCACTGGTGAAGCTGGG + Intronic
1064340409 10:14480463-14480485 AGCTACCCAATAGGGGAACTCGG + Intergenic
1074370104 10:112893827-112893849 ACCTAACCACAAGGGAATCTGGG - Intergenic
1090976489 11:131684388-131684410 GGCTACCCACTAGGGAGTGTGGG - Intronic
1091127661 11:133115790-133115812 TGTTACCAATTAGTGAATCTGGG - Intronic
1093295589 12:17386686-17386708 AGCTACCCAAGTGGGAATCTTGG - Intergenic
1105874550 13:24540871-24540893 AGCCACCCACGAGAGAATCTGGG - Intergenic
1106036032 13:26046490-26046512 AGGAACCCACCAGTGACTCTCGG + Exonic
1110505821 13:76284908-76284930 AGCTAGCTACAAGGGAATCTAGG - Intergenic
1111275522 13:85940506-85940528 AGCTACCTACTAATGGAACTAGG - Intergenic
1116470877 14:45284076-45284098 ACATAACCACTATTGAATCTTGG - Intergenic
1119330848 14:73792436-73792458 AGCTCCCCACTAGAGACTCTGGG + Intergenic
1127954515 15:63841570-63841592 AGCTAACATCTATTGAATCTTGG + Intergenic
1127960234 15:63885130-63885152 TGCTACCCACTACTGAGTGTGGG + Intergenic
1132032898 15:98452824-98452846 AATTACCCACTTCTGAATCTTGG - Intronic
1135390420 16:22088761-22088783 AACTAGCAACTGGTGAATCTGGG + Intergenic
1138814253 16:60186265-60186287 AGCTACTCACTAGTGACTCAAGG - Intergenic
1142807635 17:2379834-2379856 TGCTGCCCACGAGTGAACCTGGG + Exonic
1149109449 17:53009748-53009770 AGCTACCCCTTAGTCAATCTGGG + Intergenic
1157558579 18:48630256-48630278 AGGCATCCACTAGGGAATCTTGG + Intronic
1159617564 18:70598870-70598892 AGCACCCCACTAGGGACTCTGGG - Intergenic
926334151 2:11850563-11850585 AGCTACCCAAAATTGATTCTGGG - Intergenic
930263791 2:49176597-49176619 AGCTACTGCCTAGTGAATCTGGG + Intergenic
930806408 2:55494987-55495009 AGCTACTCACTTGGGAAGCTGGG + Intergenic
935373017 2:102367034-102367056 ATCTACCCTCCAGTGACTCTCGG - Intronic
942706988 2:178785408-178785430 AGATAACCACTTGTGACTCTAGG + Intronic
943249004 2:185493882-185493904 AGTCACCCAGTAGTGAACCTAGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1170587120 20:17743114-17743136 AACTCCCTACTATTGAATCTGGG + Intergenic
1182604279 22:31490949-31490971 AGCTCCCTTCTTGTGAATCTTGG + Intronic
950885287 3:16357276-16357298 AGCTACCCACTAGTGAATCTTGG + Intronic
956742887 3:72288967-72288989 AGCTGCCCACGAGTGATTCCAGG + Intergenic
962300471 3:134237620-134237642 AGCTACCTACTGGTGAAGCCAGG - Intronic
963486364 3:145938957-145938979 AGCTATCACCTAGTGAATATAGG - Intergenic
963694932 3:148554307-148554329 AGCTATCCACAAAGGAATCTTGG + Intergenic
973689798 4:53415236-53415258 ATCTACCCTCCAGTGAATTTTGG + Intronic
976110764 4:81670986-81671008 AGCTAGCCAGTGGTGGATCTAGG + Intronic
987264989 5:16244011-16244033 TGCTCTCCACTAATGAATCTGGG + Intergenic
999035617 5:148345783-148345805 AGCTAGCCAGTAGTGAAGCTGGG - Intergenic
1004018324 6:11752721-11752743 AACTACCCACTAGGGAATAATGG + Intronic
1005594340 6:27364420-27364442 ACCTACCAACTATAGAATCTTGG + Intergenic
1012992143 6:105936937-105936959 AGCTACCAACTGGTGGAACTGGG - Intergenic
1013238634 6:108222435-108222457 AGCAACCCATTAGTGGATCATGG + Intronic
1020936175 7:14466534-14466556 AATTACACTCTAGTGAATCTTGG - Intronic
1030444744 7:109635367-109635389 AGATACTAATTAGTGAATCTAGG + Intergenic
1033680449 7:143589312-143589334 ATGTAACCACTGGTGAATCTAGG - Intergenic
1033704445 7:143872500-143872522 ATGTAACCACTGGTGAATCTAGG + Intronic
1037959007 8:23082530-23082552 AGCTGAACATTAGTGAATCTTGG + Intergenic
1043936702 8:86150650-86150672 AGGTACCCACTAGGGAAACAAGG + Intronic
1044168551 8:89020178-89020200 AGGGATTCACTAGTGAATCTAGG - Intergenic
1047301675 8:123618787-123618809 AGCTAACAATTAGTGAACCTGGG - Intergenic
1048179800 8:132184403-132184425 AGCTCCCGACAAGTGGATCTCGG - Intronic
1048413487 8:134200272-134200294 AGCTGCTCAGTAGTGAAGCTGGG - Intergenic
1050241032 9:3635623-3635645 AGTTACGCACCAGTGAAGCTGGG - Intergenic
1055576450 9:77664576-77664598 AGTTAACAACTGGTGAATCTAGG - Intergenic
1059022385 9:110590594-110590616 AGCTCCTCACTGGTCAATCTGGG + Intergenic
1060002348 9:119969875-119969897 AGCTAGCCAGTAGTGGAGCTGGG - Intergenic
1185773735 X:2785762-2785784 AGATACACACTTGGGAATCTAGG - Intronic
1191129076 X:56989132-56989154 ATCTCCCCACTAGTGTATATTGG + Intronic
1191726812 X:64290483-64290505 AGTTACCCACTGGGGAAACTGGG - Intronic