ID: 950887449

View in Genome Browser
Species Human (GRCh38)
Location 3:16374112-16374134
Sequence CATGAGATGGTGAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 386}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950887449_950887458 8 Left 950887449 3:16374112-16374134 CCTTTCACCTTCACCATCTCATG 0: 1
1: 1
2: 0
3: 38
4: 386
Right 950887458 3:16374143-16374165 CCAAACTTGATGAGAGGGGGTGG 0: 1
1: 0
2: 2
3: 7
4: 129
950887449_950887453 3 Left 950887449 3:16374112-16374134 CCTTTCACCTTCACCATCTCATG 0: 1
1: 1
2: 0
3: 38
4: 386
Right 950887453 3:16374138-16374160 CTCTCCCAAACTTGATGAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 117
950887449_950887454 4 Left 950887449 3:16374112-16374134 CCTTTCACCTTCACCATCTCATG 0: 1
1: 1
2: 0
3: 38
4: 386
Right 950887454 3:16374139-16374161 TCTCCCAAACTTGATGAGAGGGG 0: 1
1: 0
2: 1
3: 9
4: 124
950887449_950887452 2 Left 950887449 3:16374112-16374134 CCTTTCACCTTCACCATCTCATG 0: 1
1: 1
2: 0
3: 38
4: 386
Right 950887452 3:16374137-16374159 ACTCTCCCAAACTTGATGAGAGG 0: 1
1: 0
2: 1
3: 3
4: 110
950887449_950887459 14 Left 950887449 3:16374112-16374134 CCTTTCACCTTCACCATCTCATG 0: 1
1: 1
2: 0
3: 38
4: 386
Right 950887459 3:16374149-16374171 TTGATGAGAGGGGGTGGCCCTGG 0: 1
1: 0
2: 0
3: 22
4: 237
950887449_950887455 5 Left 950887449 3:16374112-16374134 CCTTTCACCTTCACCATCTCATG 0: 1
1: 1
2: 0
3: 38
4: 386
Right 950887455 3:16374140-16374162 CTCCCAAACTTGATGAGAGGGGG 0: 1
1: 0
2: 1
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950887449 Original CRISPR CATGAGATGGTGAAGGTGAA AGG (reversed) Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901798378 1:11693085-11693107 CACGAGGAGGTGAAGGTGACAGG - Intronic
902301730 1:15506915-15506937 CATTTCATGGTGGAGGTGAAGGG - Exonic
902698039 1:18153603-18153625 CATAGGATGGTGAGGATGAAAGG - Intronic
902773391 1:18659513-18659535 CCTTAGAAGGTGAAGGTAAATGG - Intronic
903620449 1:24694309-24694331 GATGAGATGGTGAAGGGCAAAGG - Intergenic
904090382 1:27940938-27940960 AATAAGATAGTGAAGGAGAAAGG - Intronic
904424731 1:30415956-30415978 GATGAGATGGTGTGGGTGAGGGG + Intergenic
904608701 1:31713560-31713582 CTTGAGATGGGGAAGGGGAATGG + Intergenic
905240429 1:36577446-36577468 AATGAGTTGGTGAAGGTCACCGG - Intergenic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908047204 1:60183993-60184015 CATGAGATAGTGAATGGGAAAGG + Intergenic
908773356 1:67616130-67616152 CATGAGACCCTGAAGCTGAAAGG - Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
912943286 1:114063731-114063753 CAGGAGATGCTGAAGCTGATAGG - Intergenic
913260077 1:116989831-116989853 CCTCAGATGGTGAGGGTGAGGGG - Exonic
914895646 1:151669621-151669643 CAGGAGATGGTGGTAGTGAAGGG - Intronic
916934005 1:169609191-169609213 CATGGGATGGGGAAGGGTAATGG - Intronic
918732783 1:188019145-188019167 CATGAAATGGTTATGGAGAAAGG - Intergenic
918913561 1:190605576-190605598 GATAAGATGGTGAAGGTCAGAGG - Intergenic
920045955 1:203132523-203132545 TAACAGATGGTGAAGGGGAAAGG - Intronic
920286776 1:204885359-204885381 AAGGGGAGGGTGAAGGTGAAGGG - Intronic
920333800 1:205230484-205230506 AGTGAGATGGTGAGGGGGAAGGG + Intronic
920516624 1:206589294-206589316 CGTAAGATGGTGAAGTTCAAGGG - Intronic
921730122 1:218568428-218568450 CATGTGCTGGTGATGGTAAAGGG + Intergenic
921879018 1:220232447-220232469 CATAATACGGTGAAGGTGATAGG - Intronic
1063468052 10:6261029-6261051 CAAGTGATGGTGAAGATGCAGGG - Intergenic
1064344675 10:14521239-14521261 CCCGAGTTTGTGAAGGTGAAAGG - Exonic
1064542953 10:16423777-16423799 CAGGAGGTGGTGGTGGTGAAAGG + Intergenic
1065845347 10:29738481-29738503 CATGAGATGGAGTAGGGGATAGG - Intergenic
1066535623 10:36387951-36387973 CATAGGGTGGTGAAGATGAAGGG - Intergenic
1066643246 10:37578104-37578126 CATAGGGTGGTGAAGATGAAGGG - Intergenic
1067016349 10:42758608-42758630 CAGGAGTTGGTGAAGGGGACAGG - Intergenic
1067140403 10:43651527-43651549 CATGAGACTGTGAAGGTCTAGGG + Intergenic
1067349122 10:45459703-45459725 CACTACATTGTGAAGGTGAATGG + Intronic
1068104688 10:52599661-52599683 AATGAGATGGAAAATGTGAATGG + Intergenic
1068153027 10:53158506-53158528 CATAATATGGTAAAGGTGATGGG - Intergenic
1069078508 10:64063818-64063840 CATGTGAAGTTGAAGGTGGAAGG + Intergenic
1069728036 10:70593807-70593829 CAGGTGATGGAGAACGTGAATGG + Intergenic
1070854230 10:79593776-79593798 CCTGAGATGGTGCAGGAGAATGG - Intergenic
1071137591 10:82469804-82469826 GATTAGATGGTGAAAATGAATGG + Intronic
1071320968 10:84457061-84457083 AATGAGAATGTGAAGGTGCAGGG - Intronic
1071342153 10:84659144-84659166 GCTGTGATGGTGAAGGTCAAAGG - Intergenic
1071959645 10:90797896-90797918 CATGAAATGGTGCAGCAGAAAGG - Intronic
1072564992 10:96609969-96609991 CATGGGAAGGGGAAGGGGAAGGG + Intronic
1073339172 10:102732041-102732063 TCTGAGATGGTAAAGGGGAAGGG - Intronic
1074213794 10:111364318-111364340 CCTGAGAAGGTGTAAGTGAAGGG - Intergenic
1075248190 10:120843432-120843454 AATGAGATGATGCAGGTAAAAGG + Intergenic
1075300467 10:121318189-121318211 CTTGAGATGATAAAGGTCAATGG - Intergenic
1077173203 11:1177475-1177497 CATGGGAAGGTGGAGGTGATCGG + Intronic
1077187109 11:1240333-1240355 CAGGCGGTGGTGAAGGTGAATGG - Exonic
1077365294 11:2159115-2159137 CATGAGCTGGGGCAGGTGCAGGG - Intronic
1078470448 11:11581872-11581894 AATTAGATGTTGAATGTGAATGG - Intronic
1078566723 11:12421127-12421149 CATGAGATGGACAAGGTGGTGGG + Intronic
1079081931 11:17419731-17419753 ATTGAGACGGTGGAGGTGAAGGG + Intronic
1079132497 11:17755661-17755683 CATGAGATGGAGAGGCTGCAGGG + Intronic
1079212738 11:18477624-18477646 TATGAGATGGTCAAAATGAAAGG + Exonic
1079535071 11:21504304-21504326 AATGAGATAATGAACGTGAATGG - Intronic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1080181358 11:29430267-29430289 CATGAGATGGTACAGGTCAAAGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1080961465 11:37165739-37165761 CATGGGATGGTGAGAGTGCAAGG + Intergenic
1081280464 11:41203308-41203330 GATGAGATTGTGAAAATGAAAGG - Intronic
1082930151 11:58594440-58594462 CATAAGTTTGAGAAGGTGAAAGG - Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083330092 11:61893400-61893422 GAAGAGATGGGGAAGATGAAGGG + Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083788102 11:64965507-64965529 CTTAGGATGGTTAAGGTGAAAGG - Intronic
1084681112 11:70666976-70666998 CAGGAGCTGTGGAAGGTGAAGGG + Intronic
1084850106 11:71932239-71932261 AATGAGATGATGCAGGTAAAGGG - Intronic
1085341658 11:75735343-75735365 CTTGAGCTGGTGTAGGTCAAGGG + Intergenic
1085448446 11:76616394-76616416 AATGTGATGGTGCTGGTGAAGGG - Intergenic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1086432608 11:86749698-86749720 CATGATAGAGTGAAGGAGAAGGG + Intergenic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086789175 11:91014137-91014159 CAAGAGGTGGTGAGGGTGTAAGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087563889 11:99828421-99828443 CATCATATGGTGAAGATGGAAGG + Intronic
1088827387 11:113507344-113507366 CATGAGATTGTGGGGGTGCAGGG - Intergenic
1088960933 11:114663535-114663557 CAGGAGATGGTGAAGGGGCCTGG - Intergenic
1088971000 11:114774716-114774738 CAAGAGATGGGGAAGGAAAAAGG - Intergenic
1090703558 11:129316582-129316604 CAAGAGAGGGAGGAGGTGAAGGG - Intergenic
1091272478 11:134327387-134327409 CCTGAGATGGGGAAGGTCATGGG - Intergenic
1091688214 12:2578702-2578724 CTTGAGACGGGGAAGGTGATGGG + Intronic
1091714894 12:2770121-2770143 GATGAGAAGGGGAAGGTCAAAGG - Intergenic
1092161544 12:6317980-6318002 GATGAGGTGGAGAAGGTGAGAGG + Exonic
1092192123 12:6528743-6528765 AAGGACATGGTGAAGGTGAAGGG + Exonic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1093833485 12:23796277-23796299 AATAAGATGGTGATGGTCAATGG + Intronic
1094797610 12:33994198-33994220 CATGAGAAGGTAGAGTTGAAAGG - Intergenic
1095712916 12:45309146-45309168 CATGAAAGGGAGAAGGTGATTGG + Intronic
1095781652 12:46066954-46066976 AGTGGCATGGTGAAGGTGAAAGG - Intergenic
1096028624 12:48390652-48390674 CAGGAGATGCTCAAGGAGAATGG - Intergenic
1096825349 12:54272308-54272330 CTTGAGATGGTGTACTTGAAAGG - Intronic
1096867090 12:54571063-54571085 CAGTAGATGTTAAAGGTGAAGGG + Intronic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1097836685 12:64280580-64280602 CATGAAATGGGAAAGATGAAGGG + Intronic
1098384984 12:69909103-69909125 CATGATATGTTAAAGGTGATTGG + Intronic
1099565196 12:84233797-84233819 CAAGAGATGCTTAAGGAGAAAGG - Intergenic
1099896279 12:88651386-88651408 TAGGAGATGGTGTAGGTGATAGG + Intergenic
1099989504 12:89708386-89708408 CGGGAGATTGTGAAGGTGAGCGG - Intronic
1100279458 12:93104431-93104453 CATCAGATGATGAAAGTGATTGG - Intergenic
1100811099 12:98339091-98339113 AATGAGATGTTGATGGTGTATGG + Intergenic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1101522019 12:105492855-105492877 CATGCAATGGGGAAGGTGAGTGG - Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1102027080 12:109719737-109719759 TATAAGATGGTGGAGGTGAAAGG + Intronic
1105676744 13:22679856-22679878 CATTTGATGGTGATGGTGATAGG - Intergenic
1106329239 13:28723953-28723975 CAGGCGATGGAGAAGGTGACAGG - Intergenic
1107260730 13:38487720-38487742 CATTATATTGTGAATGTGAAGGG - Intergenic
1107398171 13:40040614-40040636 CTTTTGATGGTGAAGATGAAGGG - Intergenic
1108113016 13:47097553-47097575 CAGGAGATGGTGAAGCAAAAAGG + Intergenic
1108269133 13:48741264-48741286 CATCAGAAGGTGGAGGTCAATGG + Intergenic
1111002411 13:82203012-82203034 CATTAGATGGTGAGAGTGTATGG + Intergenic
1112605708 13:100904011-100904033 CATGAGATGGAGTAGGGGAAGGG - Intergenic
1113184321 13:107670044-107670066 CAGTAGATGGTGAAGTAGAAAGG - Intronic
1113268144 13:108642262-108642284 CATGAGACTGTGGACGTGAAAGG + Intronic
1113697456 13:112356092-112356114 AATGAGATGGCGATGGAGAAAGG - Intergenic
1114069099 14:19094168-19094190 CAGGAGTTGGTGAAGGGGACAGG + Intergenic
1114093161 14:19305835-19305857 CAGGAGTTGGTGAAGGGGACAGG - Intergenic
1115057542 14:29148569-29148591 CATGCTATGGGGAAGGTAAAGGG + Intergenic
1115786979 14:36837323-36837345 CAGGAGAAGGAGGAGGTGAAGGG + Intronic
1115857581 14:37647544-37647566 TCTGAGATGGTGAAGATCAAGGG + Intronic
1118122775 14:62864537-62864559 GATGAGTTGGTCAAGGTGGAAGG + Intronic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118408829 14:65454924-65454946 CATGAGATGGTGCATGTATAAGG + Intronic
1118602773 14:67482154-67482176 CAGGTGATGGGGAAGGGGAAGGG + Intronic
1118746227 14:68775496-68775518 GCTGAAATGGTGAGGGTGAAGGG - Intergenic
1119648139 14:76363450-76363472 TATGACATGGAGAAGATGAAGGG - Intronic
1120741223 14:88110866-88110888 AATGAAATGGTGATGGTGATTGG - Intergenic
1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG + Intronic
1121086155 14:91147672-91147694 CATGAGAGGATCAAGTTGAAAGG + Intronic
1121336954 14:93083437-93083459 CATGAAATGGTGAAGAAGCAAGG + Intronic
1121614665 14:95305141-95305163 CATGAGTTACTGGAGGTGAAGGG - Intronic
1123798933 15:23801751-23801773 CATGAGATAGTGCAGGGCAAAGG + Intergenic
1123954981 15:25325843-25325865 CTTGAGATGATGCAGGTGCATGG - Intergenic
1125182449 15:36893017-36893039 CAAGAGATTGTAAAGGTCAAAGG + Intronic
1125447319 15:39772039-39772061 TATGAGATGATGGATGTGAAAGG - Intronic
1125895448 15:43298170-43298192 CAGGAGATTGTGCAGGTTAAGGG - Intronic
1126347111 15:47707864-47707886 CATGAGGTGGAAAAGGTTAATGG - Intronic
1129158091 15:73731331-73731353 CGTGAGGTGGGGAAGGGGAAGGG - Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130534100 15:84770873-84770895 CATAAGATGTTAAAGCTGAAGGG - Intronic
1130847688 15:87762505-87762527 CATGACTTGGTGAAGATGAAAGG + Intergenic
1131342897 15:91619465-91619487 CATGAGCTGGAGCAGGTGAAGGG - Intergenic
1131695376 15:94871541-94871563 CATGAGATGATGGAATTGAAGGG + Intergenic
1131735124 15:95323794-95323816 CATGAGTAGCTCAAGGTGAAAGG - Intergenic
1133069695 16:3236988-3237010 GATGAGATTGTGAAGGTCAAAGG - Intergenic
1133480464 16:6165833-6165855 AATGAGATTTTTAAGGTGAAGGG + Intronic
1133518214 16:6530750-6530772 CATGAGATGGGGGTGGGGAAGGG - Intronic
1134211317 16:12279818-12279840 GATGAGCTAGAGAAGGTGAAAGG + Intronic
1135085590 16:19472287-19472309 GATGAGATGCTGGAGGGGAAGGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141388741 16:83646882-83646904 CATTAGCAGGTGAAGGGGAAAGG - Intronic
1143525065 17:7467042-7467064 CAGGTCATGGTGAAGGTCAAGGG + Intronic
1143711225 17:8736567-8736589 CACGAGATGGAGAAGGTGCTCGG - Intronic
1144235101 17:13253064-13253086 AATGAGATCATGTAGGTGAAAGG - Intergenic
1146230996 17:31109120-31109142 CAAGAGTGGGTAAAGGTGAAAGG - Intronic
1147367125 17:39966331-39966353 CCAAAGACGGTGAAGGTGAAGGG + Exonic
1147722650 17:42548359-42548381 GAGGAGGTGGTGAAGGTGAGCGG + Intergenic
1148037704 17:44680477-44680499 CATGAGTTCCTGAAGGTAAAGGG + Intronic
1148688393 17:49513256-49513278 CCTGAGATGGTGACGGGGCAGGG - Exonic
1150497271 17:65617536-65617558 CCTGAGTTGGTGAATGAGAAAGG + Intronic
1151237314 17:72730428-72730450 TATGACATGGTAAAGTTGAAAGG - Intronic
1153325507 18:3815190-3815212 TATGAGATGGTAAAGTCGAAAGG - Intronic
1153328081 18:3842274-3842296 AATGAGATTGTGAAGGAAAAAGG + Intronic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1155049793 18:22136724-22136746 CATGAGGTGGTGAAGGAGATTGG + Intergenic
1156748223 18:40418421-40418443 CATGAGATAGTGAACGATAAAGG - Intergenic
1157241999 18:46019448-46019470 CATAAGATGGGTAAAGTGAATGG - Intronic
1157403978 18:47408428-47408450 CCTGAGAAGGGGAAGGGGAAGGG + Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1158173282 18:54623235-54623257 CATGAGTTGGGGAATGTAAAAGG - Intergenic
1158811915 18:61047533-61047555 CATAACATGGGGAGGGTGAAAGG + Intergenic
1159527807 18:69616312-69616334 CATGGCATGGTGGAGGTGAGGGG - Intronic
1160288813 18:77571726-77571748 CTTGAGATGGGGAAGGTGAGTGG + Intergenic
1160310734 18:77787498-77787520 CAAGAGATATTGAAGGAGAATGG + Intergenic
1161546035 19:4880640-4880662 CATGAGATGATGCAGGTAACTGG + Intergenic
1161681621 19:5682485-5682507 CATGAGCTCGTGGGGGTGAAAGG + Intronic
1162134323 19:8545803-8545825 GATGAGATGGAGAAGGGGAGAGG - Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1163021230 19:14481988-14482010 CATGAGATGGTGGAGGCTAGAGG - Intronic
1163361314 19:16847905-16847927 CAGGAGCTGGGGGAGGTGAATGG - Intronic
1164397207 19:27876710-27876732 CAGGACCTGGTGAAGGGGAAGGG + Intergenic
1164873442 19:31666596-31666618 CATCAGAAAGTGAAGGTGGATGG - Intergenic
1165385047 19:35505417-35505439 TTTGAGATGGGGAAGGTTAAGGG - Intronic
1165934574 19:39381343-39381365 CATGAGATGGGGTAGGAGTAAGG - Intronic
1166276625 19:41758501-41758523 CATGAGATGGGGTAGGTTTAGGG - Intronic
1166985738 19:46659340-46659362 GCAGAGATGGGGAAGGTGAAGGG + Intronic
1168246433 19:55114977-55114999 CATGAGATGGTGGACGAGGAAGG + Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
1168677177 19:58286997-58287019 AATGAAATGGAGAAGATGAAGGG - Intronic
924989076 2:295713-295735 GATGAGATGGTGAGGGCGAAGGG + Intergenic
925214788 2:2085070-2085092 CATGAGAGGGCAGAGGTGAAAGG - Intronic
925651437 2:6093738-6093760 GAAGAGATGGAGGAGGTGAAAGG + Intergenic
925661474 2:6207833-6207855 CATTAAATGGTGAAACTGAATGG + Intergenic
925785367 2:7427234-7427256 CATCAGATGAGGAAGGTGCATGG + Intergenic
926636481 2:15185236-15185258 CAGAAGGTGGTGAAGGTTAAAGG + Intronic
929762515 2:44817777-44817799 CAGGAGATGGTGGGGGTGAGGGG - Intergenic
930566950 2:53033072-53033094 CATATGATGGAGAAGGTGAAAGG - Intergenic
930639189 2:53838027-53838049 CAAGAAAAGGTGAAGGTGTAAGG + Intergenic
930848087 2:55926964-55926986 ACTGAGATGGTGAAGGTGGGTGG - Intergenic
934662810 2:96152334-96152356 CATGAGATGGAGCAGGGGAGAGG + Intergenic
934833901 2:97564670-97564692 GATCAGATGGTGTAGGTGTATGG + Intronic
935129875 2:100253648-100253670 CATGAGAGGCTGCAGCTGAAGGG - Intergenic
936005562 2:108884010-108884032 ACTGAGATGGCTAAGGTGAAAGG - Intronic
936496092 2:113022734-113022756 CCTGAGATGGTGATGTTGAAAGG + Exonic
937549035 2:123063785-123063807 GAGGAGGTGGAGAAGGTGAAAGG + Intergenic
937662036 2:124442020-124442042 CATTAGATGGAGTAAGTGAAAGG + Intronic
938196186 2:129330796-129330818 CATGTGCTGGGGAAGGTGGAGGG + Intergenic
938565875 2:132518256-132518278 CATGAGATTGTGAAGGATCAAGG + Intronic
939393348 2:141597462-141597484 CATTAGGATGTGAAGGTGAAGGG - Intronic
940333205 2:152498088-152498110 CATTATATGGCAAAGGTGAAAGG - Intronic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
942204297 2:173604154-173604176 TATACTATGGTGAAGGTGAAGGG + Intergenic
942613784 2:177768688-177768710 CATCAGATGTTGGAGTTGAAAGG + Intronic
943122965 2:183760472-183760494 TATGAGATTTGGAAGGTGAAAGG + Intergenic
943692083 2:190880174-190880196 CATGGGAGGGTGGAGGTGGAGGG - Intergenic
944442450 2:199756336-199756358 CAGGAGAAGGTGTGGGTGAAAGG + Intergenic
945192113 2:207199435-207199457 GATGAGATGCTGAAAGTGAAAGG - Intergenic
946389713 2:219408263-219408285 CATGAGATGATGGAGATGAAAGG - Intergenic
947350302 2:229236500-229236522 CCTGAAATGGTAAAGGAGAAAGG + Intronic
948190135 2:236051902-236051924 CAGGAGGTGGTGAAGGTGGTGGG - Intronic
948387995 2:237593599-237593621 TATTACATGGTAAAGGTGAAGGG - Intronic
1170138522 20:13102319-13102341 AATGAGTTGGTGAATGTAAATGG - Intronic
1170312778 20:15011098-15011120 CATGAGAAAGTAGAGGTGAAAGG - Intronic
1170578887 20:17683077-17683099 CATGCGTTGGGGAAGGTGAGAGG + Intergenic
1172012102 20:31851519-31851541 CTGAAGATGGTGGAGGTGAAGGG + Intronic
1173216490 20:41089781-41089803 CAAGTGTTGGTGAAGGTGTAGGG - Intronic
1174118539 20:48244847-48244869 CAAGAGATGGTGGATGAGAAGGG - Intergenic
1174142119 20:48422656-48422678 AATGAGATGGTGCAGGCCAAAGG - Intergenic
1174476625 20:50800377-50800399 CAGGAGATGGGGCAAGTGAAGGG + Intronic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175252351 20:57617088-57617110 TAGGAGATGGTGAAGAGGAAGGG - Intronic
1175502580 20:59460887-59460909 CAGGAGATGGTGAAAATGGAGGG - Intergenic
1177140949 21:17357483-17357505 CATCAGATGGTAAAGATCAAGGG - Intergenic
1179477858 21:41659465-41659487 GAAGAGAGGGTGAGGGTGAACGG + Intergenic
1179633168 21:42691152-42691174 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179633204 21:42691342-42691364 CTTTGGATGGTGATGGTGAAGGG - Intronic
1179658751 21:42861520-42861542 CGAGAGATGGTGAAGGGGAGGGG + Intronic
1180487573 22:15816731-15816753 CAGGAGTTGGTGAAGGGGACAGG + Intergenic
1180857276 22:19056465-19056487 CCTGTGATGGTGAAGAGGAAGGG + Intronic
1182973595 22:34600954-34600976 AAGGACATGGTGAAGCTGAAAGG - Intergenic
1183309121 22:37099850-37099872 TATGAGATGGGGAAGGGGAGAGG + Intronic
1184013544 22:41767895-41767917 GAGGAGATGGAGGAGGTGAAGGG + Intronic
1184259966 22:43309120-43309142 CTGGAGCTGGTGAAGGTGCAGGG - Intronic
1185178781 22:49347467-49347489 GATGAGCTGATGAAGGTGAGGGG + Intergenic
949097380 3:101404-101426 TAGGACAGGGTGAAGGTGAATGG - Intergenic
949422013 3:3875707-3875729 CTTGAAATGTTAAAGGTGAATGG - Intronic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
953055003 3:39381041-39381063 CATGGGAAGCTGGAGGTGAATGG - Intergenic
953593407 3:44283034-44283056 CATGAGATGTGGAAGGAAAAAGG + Intronic
954447181 3:50553102-50553124 AAAGAGAAGGTGAAGATGAAGGG + Intergenic
954886922 3:53882715-53882737 ACTGAGATGGTGAAAGTGAGAGG - Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955472848 3:59304041-59304063 AATGGGATGGAGGAGGTGAAAGG - Intergenic
955546269 3:60034183-60034205 CAGAAGAGGGTCAAGGTGAATGG + Intronic
955567089 3:60258941-60258963 TATGAGAAGGGGAAGGGGAAGGG + Intronic
956900714 3:73713241-73713263 CATGAGCTAGTGGAGGTGGAAGG + Intergenic
957019150 3:75104908-75104930 GATGAGATGAGTAAGGTGAATGG - Intergenic
957245335 3:77709341-77709363 CATGAGATGATGCAGCTGGAAGG - Intergenic
957627153 3:82668029-82668051 CATTAGGTTGTCAAGGTGAAGGG - Intergenic
959469385 3:106731097-106731119 AATGAGATGATGAGGGTGAAAGG + Intergenic
960504561 3:118477509-118477531 CCTGATATGGGGAAAGTGAAAGG + Intergenic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
963901472 3:150737095-150737117 CGTGATATGGTGAAGGGGCATGG + Intergenic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
964525847 3:157614671-157614693 CAGGAGAGGATGAAGGTAAATGG + Intronic
964863831 3:161231759-161231781 CAGGAGATCTAGAAGGTGAAGGG + Intronic
965179445 3:165383245-165383267 GATGAGATGGAAAAGGAGAAAGG + Intergenic
965294247 3:166923538-166923560 CATGAGATGTGGAAGGAGCAAGG - Intergenic
966850787 3:184164045-184164067 CATGGGGTGGTGAAGTGGAATGG - Intronic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
968669771 4:1842911-1842933 CAGGAGATCGTGAGGCTGAATGG - Intronic
969613567 4:8240009-8240031 CTTGAGATGGTAAAGGGGAATGG + Intronic
969725777 4:8917276-8917298 CATGAGTTAGTGCAGGTAAAGGG + Intergenic
972757535 4:42063835-42063857 CATGAGATGCAGAAGCTGAGAGG - Intronic
973851845 4:54968564-54968586 CATGATTTGGGGAAGATGAAGGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974255352 4:59446459-59446481 CAAGTGTTGGTGAAAGTGAAAGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974902178 4:68014268-68014290 CCTGAGATGGTGTTGGTGATAGG + Intergenic
977064847 4:92302552-92302574 CTTGAGATGGTGAAGGAGAGTGG + Intronic
977983620 4:103356712-103356734 CATGGGATGATGAAGTAGAAAGG - Intergenic
978623113 4:110654442-110654464 CATAAGATGCTGAAGTTGGAAGG + Intergenic
980518760 4:133902473-133902495 CGTGAGATGGGGTAGGGGAAAGG + Intergenic
980802110 4:137765363-137765385 CATGGGATGCTGAAAGTGGATGG + Intergenic
980930926 4:139181986-139182008 CCTGAGAATGTGAAGTTGAAAGG - Intergenic
981152384 4:141394430-141394452 CAGGAGATGGTGATGCTGACTGG + Intergenic
981436158 4:144724918-144724940 CATAAAATGGAGAATGTGAATGG + Intronic
982574356 4:157089922-157089944 GATGAGATGATGAAAGTGAAAGG - Intronic
984163780 4:176284595-176284617 TATGATATGGTTAAGGAGAATGG + Intergenic
985874039 5:2581771-2581793 CAGGAGGTGGTAAAGGAGAAGGG + Intergenic
986185575 5:5433347-5433369 TTTGAGAAGGTGAAGGGGAATGG - Intronic
986322176 5:6641009-6641031 AATGGGATGGTGTAGGAGAAGGG + Intronic
986984240 5:13481998-13482020 CATGAGCAGGTGTAGGTGCATGG - Intergenic
987018921 5:13849664-13849686 CATGAGAAAGTTAAGGTCAAAGG - Intronic
987276876 5:16372295-16372317 CAGGAGGGTGTGAAGGTGAAGGG - Intergenic
987496369 5:18650476-18650498 AATGAGATGCTGAATGTAAATGG - Intergenic
987938157 5:24496409-24496431 TCTGAGATGGAAAAGGTGAAGGG + Intronic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
990275170 5:54187810-54187832 CATAAGACATTGAAGGTGAAAGG - Intronic
991389360 5:66125724-66125746 ACTGAGGTGGTGAAGGTGCAGGG + Intergenic
993463414 5:88214698-88214720 CATGTTATGGGGAAGGAGAAAGG - Intronic
994069439 5:95583123-95583145 CAGAAGATGGTGAAGGGTAAGGG - Exonic
994796886 5:104314733-104314755 AATGAGATTTTGCAGGTGAAAGG + Intergenic
995183045 5:109246731-109246753 AATGAGATGGACAAGGAGAAAGG + Intergenic
995944154 5:117622302-117622324 CATAAGGTTGTGAAGATGAAAGG - Intergenic
996019102 5:118572798-118572820 TATGATATGGTGAGGGTGAGTGG - Intergenic
996087371 5:119318721-119318743 CATGAGATGGTGAGGAGGAAGGG - Intronic
996980588 5:129488745-129488767 AATGACATGGTGGAAGTGAAAGG + Intronic
997585710 5:135041804-135041826 GATGGGATAGTGAAGGTGAGGGG + Intronic
997873956 5:137531807-137531829 GATGTGAAGGTGCAGGTGAATGG - Intronic
998269827 5:140696542-140696564 CATGAGATGGTGGTGAAGAAAGG + Exonic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
1000051128 5:157563738-157563760 CATGTAATGGAGGAGGTGAATGG - Intronic
1001086780 5:168706166-168706188 CATGCAAGGGTAAAGGTGAAAGG + Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003512393 6:6792325-6792347 GTTGAGATGGTAAAGGTGAATGG - Intergenic
1005443362 6:25895817-25895839 AATGAGGTGTTGAAAGTGAATGG + Intergenic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006742150 6:36316698-36316720 CATGAGATGGGAGAGGTGCAAGG + Exonic
1007941481 6:45785589-45785611 CATGAGGTGGTCAACGTGACTGG + Intergenic
1007977697 6:46118409-46118431 CAAGATATTTTGAAGGTGAAAGG + Intergenic
1008323683 6:50149953-50149975 AATGAGATGTGGAAGGAGAAGGG + Intergenic
1009501023 6:64413934-64413956 TATGTGGTGGAGAAGGTGAATGG - Intronic
1009629653 6:66178693-66178715 TATGAGATTATGAAGGTCAAGGG - Intergenic
1010592605 6:77728037-77728059 GTTGAGAGAGTGAAGGTGAAAGG + Intronic
1011043629 6:83058214-83058236 CATATTATGGTGATGGTGAAGGG - Intronic
1011799582 6:90996611-90996633 CATGAGAGGGTTTGGGTGAATGG - Intergenic
1012103018 6:95115567-95115589 ATTTAGATGGTAAAGGTGAAGGG - Intergenic
1012669060 6:102017260-102017282 CAGGAGATGGAGAGAGTGAAGGG + Intronic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013240679 6:108242680-108242702 CATTACATGGCAAAGGTGAAGGG + Intronic
1014204645 6:118644599-118644621 CCTGAGATGGGGAAGGTTAGTGG - Intronic
1015579042 6:134703510-134703532 CCAGAGATGGTTAAGGTGAGTGG + Intergenic
1015678611 6:135779520-135779542 AAAGAGATGATGAAGTTGAAAGG - Intergenic
1015814244 6:137191690-137191712 CCAGAGATGGTGAAGGGGGAAGG + Intergenic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1017310566 6:152971491-152971513 CATGAATTGGGGAAGGTGCAAGG - Intronic
1017746287 6:157449541-157449563 CAGGAGCTGGGGAAGGGGAAAGG - Intronic
1019986463 7:4659909-4659931 CAGGTGCTGGTGATGGTGAAGGG - Intergenic
1020509665 7:9037763-9037785 GAAAAGATGGTGAAGGAGAAAGG - Intergenic
1021521066 7:21539514-21539536 CAAGAGAAGGAAAAGGTGAATGG + Intergenic
1021845766 7:24761197-24761219 ATTTAGCTGGTGAAGGTGAATGG + Intergenic
1022633754 7:32111448-32111470 CATGAGATGGTGCAGGAAACAGG + Intronic
1022896006 7:34751071-34751093 AAGGACATGGTGAAGGTAAAGGG - Intronic
1023503982 7:40881060-40881082 GATGAGATGGTGAAGGGATAAGG - Intergenic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024480235 7:49855113-49855135 AATGAGATTGTGTATGTGAAAGG + Intronic
1026508250 7:71005185-71005207 CATAAAATGGTCAAGGAGAATGG + Intergenic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1028556816 7:92134279-92134301 CAGGCGATGGAGAAGGTGACAGG - Exonic
1028767828 7:94580303-94580325 CATGAGATGGTGAAGTATAGGGG - Intergenic
1029144664 7:98437210-98437232 CATGACCTGCTGAAGGTGACAGG + Intergenic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1030562609 7:111109614-111109636 CATGAGGTGGTGAAAGTTGAAGG - Intronic
1030815740 7:114034870-114034892 CATGAGATGGGAAATGGGAATGG + Intronic
1031193545 7:118585822-118585844 TATGAGAAGGTGAAAGTGAAAGG - Intergenic
1033215122 7:139487739-139487761 AAGGTGAAGGTGAAGGTGAAGGG + Intergenic
1033741817 7:144282064-144282086 CATGAGGAGGTGAGGATGAAAGG + Intergenic
1033752084 7:144367550-144367572 CATGAGGAGGTGAGGATGAAAGG - Intronic
1034762160 7:153682943-153682965 CATAAGAAGATGAAGGTCAAAGG - Intergenic
1034893247 7:154858775-154858797 CATTAGAGGGTGAAGTTCAAGGG - Intronic
1035939029 8:3875435-3875457 AGTGAGATGATGTAGGTGAATGG + Intronic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1037614834 8:20509504-20509526 GATGAGAGGATGAAGATGAAAGG - Intergenic
1037789945 8:21929550-21929572 GATGAGATGGAGAATATGAAGGG + Intronic
1039345922 8:36705097-36705119 CCTGAGAGTGTGGAGGTGAAGGG + Intergenic
1039779729 8:40772598-40772620 AATAAGATGATGAAGGTGGAAGG - Intronic
1039823178 8:41151802-41151824 CATGAAATGTATAAGGTGAACGG + Intergenic
1039965976 8:42284178-42284200 CATCATAGGGTGAAGGCGAAAGG + Intronic
1041360124 8:57044203-57044225 AATGTGAGGGTGAGGGTGAATGG + Intergenic
1041944082 8:63422610-63422632 AATGAGATGTTGAAGGGAAAGGG - Intergenic
1043784831 8:84385828-84385850 TCTTAGATGATGAAGGTGAATGG - Intronic
1046801748 8:118436275-118436297 AATGGGATGATGAATGTGAAGGG - Intronic
1048426438 8:134328190-134328212 TATGAGTTGGTCAAAGTGAAAGG - Intergenic
1048608005 8:135990202-135990224 CAGGAGATGGTAAGGGTGAGGGG + Intergenic
1048942627 8:139415049-139415071 CATGAGAAGGTGAAGCACAAGGG + Intergenic
1049100646 8:140576617-140576639 CAAGAGCTGGTGAAGGCGGAGGG + Intronic
1049623769 8:143611099-143611121 CATGGGACGGAGAAGCTGAACGG - Intergenic
1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG + Intronic
1051788426 9:20772129-20772151 GATTAGATGGTCAAGGAGAAGGG + Intronic
1052143356 9:25017328-25017350 TATGAGAAGGGGGAGGTGAAGGG - Intergenic
1052579567 9:30337885-30337907 AATGAGATGGGGATGGTTAATGG - Intergenic
1055209652 9:73775316-73775338 CATGAGATTTTGAAGCTGAAAGG + Intergenic
1056419148 9:86407003-86407025 AATGAGAGGGTAAAGGAGAATGG - Intergenic
1057082691 9:92184969-92184991 CAGGAGATGGGGGATGTGAAGGG + Intergenic
1057719907 9:97523674-97523696 AATGAGATGGTGTAGGTGAGGGG + Intronic
1057998779 9:99844498-99844520 CATGAGACTGTGAATGTGAAGGG + Intronic
1058578243 9:106426180-106426202 CCTGAGAAGGACAAGGTGAAGGG + Intergenic
1058771769 9:108240959-108240981 AATGAGAAGGTGAAAGAGAAAGG + Intergenic
1059234155 9:112748178-112748200 CAGGAAATGGTGAATATGAATGG + Intergenic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1061731418 9:132617303-132617325 AAGGAGATGGGGGAGGTGAAGGG - Intronic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185756304 X:2655724-2655746 CAAGAGATAGAGAAGGTGAGAGG + Intergenic
1186700713 X:12087104-12087126 CAGAAGATGGTGAAGGTGCTGGG - Intergenic
1187102408 X:16207618-16207640 GAAGAGGTGGAGAAGGTGAAAGG + Intergenic
1187303534 X:18074411-18074433 CATGAGATGGGCAAGGAGAATGG + Intergenic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1189313872 X:40039898-40039920 TAAGAGATGGGGAAGGAGAAAGG + Intergenic
1189919039 X:45885417-45885439 CATGAGATGAAGAAGGAGTATGG + Intergenic
1190148842 X:47923773-47923795 CATGAGATTTGGAAGGTCAAAGG + Intronic
1190323285 X:49190998-49191020 CAATAGATGGTGAGGGTAAATGG - Intronic
1190869104 X:54410298-54410320 CATGATATGGCAAAGGTGATGGG - Intergenic
1191763760 X:64673136-64673158 AATGAGATTGTTAAGTTGAATGG - Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193082829 X:77422657-77422679 AATGAGGAGGGGAAGGTGAAGGG - Intergenic
1194515616 X:94849384-94849406 GATGAGGAGGTGAAGGAGAAGGG + Intergenic
1194832083 X:98635682-98635704 CATGAGTTGGGGATGGTTAATGG + Intergenic
1195314517 X:103664911-103664933 CATGTGTTGGTGAAGGTGTGGGG + Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1196412820 X:115438058-115438080 CAAGAGATGATGTAAGTGAAGGG + Intergenic
1196432724 X:115644184-115644206 CTTGAGGAGGTAAAGGTGAAAGG - Intronic
1196488226 X:116238918-116238940 AATGAGATAGAGAAGGGGAAAGG - Intergenic
1197342516 X:125289738-125289760 CATGAGATGATGAAGGATGAAGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1200304397 X:155009283-155009305 GATGAGTTGGTGAATGTGGAAGG - Intronic
1200835206 Y:7725829-7725851 CATGCGATGGTGAAGGTGAAAGG - Intergenic
1201393219 Y:13521417-13521439 CATGAGATAGTCTAGGTAAAAGG - Intergenic