ID: 950888191

View in Genome Browser
Species Human (GRCh38)
Location 3:16378898-16378920
Sequence TCTCCCTAAAAAATAGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950888186_950888191 10 Left 950888186 3:16378865-16378887 CCACCTGCAGTACCGAGGTACTT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 950888191 3:16378898-16378920 TCTCCCTAAAAAATAGCCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 163
950888187_950888191 7 Left 950888187 3:16378868-16378890 CCTGCAGTACCGAGGTACTTGAA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 950888191 3:16378898-16378920 TCTCCCTAAAAAATAGCCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 163
950888185_950888191 11 Left 950888185 3:16378864-16378886 CCCACCTGCAGTACCGAGGTACT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 950888191 3:16378898-16378920 TCTCCCTAAAAAATAGCCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 163
950888188_950888191 -2 Left 950888188 3:16378877-16378899 CCGAGGTACTTGAACTTTCCCTC 0: 1
1: 0
2: 1
3: 10
4: 153
Right 950888191 3:16378898-16378920 TCTCCCTAAAAAATAGCCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950888191 Original CRISPR TCTCCCTAAAAAATAGCCCA AGG Intronic
900221361 1:1511107-1511129 GCTCCCTTTAAAATAGCCAATGG - Intergenic
905178319 1:36151765-36151787 TCTCCCTAGAAAACAACACAAGG + Intronic
905281522 1:36852429-36852451 TTTCCCTGAAACATACCCCATGG - Intronic
908977976 1:69921032-69921054 TCTCCTTAAAACATTGGCCAAGG + Intronic
909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG + Intergenic
910634517 1:89392460-89392482 TGACCATAAAAAATAGCCCTAGG + Intergenic
910833466 1:91483768-91483790 TATCCCTAACAAATATACCATGG + Intergenic
914736531 1:150422760-150422782 TGTCCCTAATAAGTTGCCCATGG - Intronic
919813153 1:201421598-201421620 TCTCCTTAAACAAAAGCCCCAGG + Intronic
919821823 1:201477973-201477995 TGTCCCTAAAGTCTAGCCCAGGG - Intergenic
921488287 1:215742139-215742161 TTTCTCTAAAAAATAGACCATGG - Intronic
922535627 1:226378677-226378699 TCTCCATAAAAAATAAGGCATGG + Intronic
923087497 1:230712708-230712730 TCTGCCTCAAAAATGGCCCATGG - Intronic
923850938 1:237793870-237793892 TCTCGCTTAAAAATAACCAATGG - Exonic
1063844810 10:10114902-10114924 TCTCATTAAAAAATAGGCAAAGG - Intergenic
1063877180 10:10492513-10492535 TCTTCCAAAAAAATAAACCATGG + Intergenic
1067773677 10:49145694-49145716 TCCTCCTAAGAAAAAGCCCAAGG - Intergenic
1067988998 10:51188238-51188260 TGTCATCAAAAAATAGCCCATGG - Intronic
1067989474 10:51194533-51194555 TCTACCTAAAAAGCAGGCCATGG - Intronic
1069389908 10:67923710-67923732 TCTCTATAAAAATTAGCCCTGGG - Intronic
1070845325 10:79517904-79517926 TCTCCTTCTAATATAGCCCAGGG - Intergenic
1070928470 10:80242405-80242427 TCTCCTTCTAATATAGCCCAGGG + Intergenic
1071460400 10:85888334-85888356 TCTCCCTAAAGACTAGCACGTGG + Intronic
1071909464 10:90214592-90214614 CCTCCATTACAAATAGCCCAAGG - Intergenic
1074486015 10:113881043-113881065 TTTCCCTAAAATATACACCATGG - Intronic
1078638057 11:13070120-13070142 TCTCCATAACAAAAAGTCCAAGG + Intergenic
1079976622 11:27099685-27099707 TCTCGCTTACAAACAGCCCATGG - Intronic
1081250188 11:40821261-40821283 TTTCCCCAAAAAATAGTGCATGG - Intronic
1081689811 11:45070263-45070285 TCTACATAAAGAATAGCCCAGGG + Intergenic
1082663034 11:55938001-55938023 TCTCCCTAAAGAATGACACATGG - Intergenic
1082843844 11:57711652-57711674 TCTCTCTAAAAAATGACCTAGGG - Intronic
1087396343 11:97604631-97604653 TGTTCCTGAAAAATAGCTCACGG + Intergenic
1087445604 11:98248010-98248032 TCTCACCAAAGAAAAGCCCAGGG - Intergenic
1088146605 11:106688062-106688084 TTTCCCTAAACAAATGCCCAAGG + Intronic
1088435758 11:109811469-109811491 TCTCTCTGAAAAGAAGCCCAGGG - Intergenic
1091998931 12:5017445-5017467 TCCCCCTCAACAATAGGCCAAGG - Intergenic
1092489459 12:8932145-8932167 CATCCCTAAAACACAGCCCAGGG - Intronic
1095926927 12:47587862-47587884 TCTCAGTAAAAAATAGGTCATGG - Intergenic
1098258197 12:68639428-68639450 TCTCCTTAGAAAATAGTACAAGG + Intronic
1100803244 12:98255109-98255131 TCTCCCTTAAATCTAGACCATGG + Intergenic
1101977327 12:109371130-109371152 TCTCCCTAAAAGCATGCCCAAGG - Intronic
1104184075 12:126411372-126411394 TCACACGAAAACATAGCCCATGG - Intergenic
1110304529 13:73969773-73969795 TCTCACTTAACAATAGGCCAAGG + Intronic
1110795418 13:79631470-79631492 TTTTCATAAAAAATAGCCCGAGG - Intergenic
1111846122 13:93511013-93511035 TCTCATTAAAAAATGGCCAAAGG - Intronic
1113488894 13:110676846-110676868 TCTTCCCAAAAAATCACCCATGG + Intronic
1114227810 14:20754806-20754828 TCTGCCTGAAAATTAGCCCCTGG - Intergenic
1114466767 14:22928796-22928818 TCTCCCTAAAACACAGCCATGGG + Intronic
1115333673 14:32223857-32223879 ACACTCTGAAAAATAGCCCATGG - Intergenic
1118319954 14:64747228-64747250 GCTCCCTAAAGACTGGCCCAGGG + Exonic
1118563995 14:67119003-67119025 TCTACCTTAAAACTATCCCATGG - Intronic
1120088223 14:80299892-80299914 TCTCCCTAAAAAACTGACCTTGG - Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126532045 15:49721396-49721418 TCTTGCTAAAAACTATCCCATGG + Intergenic
1126746938 15:51835672-51835694 TCTCCCTAAAAATTGTTCCAAGG - Intronic
1128359881 15:66954542-66954564 TCTCCCTACAAAAACCCCCATGG + Intergenic
1130574298 15:85077567-85077589 TCTCCATAAATAATTGCTCAAGG + Intronic
1132959598 16:2614456-2614478 TCTCCCTCAAGGACAGCCCAAGG + Intergenic
1132972659 16:2696431-2696453 TCTCCCTCAAGGACAGCCCAAGG + Intronic
1135774855 16:25248471-25248493 TCTCATTAAAAAATAAGCCAAGG + Intronic
1137469447 16:48741433-48741455 TCTCCCTGAGAAATGGCTCAGGG - Intergenic
1139056604 16:63193449-63193471 GCTTCCTAAAACATAGCTCAAGG - Intergenic
1143981101 17:10870634-10870656 TCTCACTCAATAACAGCCCATGG + Intergenic
1146180580 17:30695728-30695750 ACTTCCTGGAAAATAGCCCAGGG - Intergenic
1146294775 17:31641004-31641026 TCTCTACAAAAAATAGCCCCTGG - Intergenic
1147958769 17:44153451-44153473 TCTCCTTTAAAAAAAACCCAAGG + Intronic
1149046165 17:52247865-52247887 GCTCCCTTAAAAATAGTGCATGG - Intergenic
1158865866 18:61637046-61637068 ACTCCCTAAAAAATGGCCAGAGG - Intergenic
1162180415 19:8865198-8865220 TCTCTAAAAAAAATAGCCCAAGG - Intronic
929728056 2:44453376-44453398 TCTCATTTAAAATTAGCCCAGGG + Intronic
931649601 2:64455292-64455314 GCCCCCCAAAAAAGAGCCCATGG + Intronic
931723211 2:65082651-65082673 TATCCCTGACAAAAAGCCCATGG + Exonic
936173905 2:110201739-110201761 TCTCCCTAAATAATGGACTATGG + Intronic
936405524 2:112199182-112199204 TCCCCCTGAGAAATTGCCCAGGG + Intergenic
941042330 2:160636398-160636420 TCTCCTTAAAAATTTGTCCAAGG + Intergenic
943911764 2:193577952-193577974 TCTCAAAAAAGAATAGCCCAGGG + Intergenic
945270550 2:207934921-207934943 TCCCCCACAAAAATAGCCCCTGG + Intronic
945634342 2:212328782-212328804 TTTCCATATAAAATAGCACAAGG - Intronic
948111579 2:235460523-235460545 TCTCCTTTACAAACAGCCCAAGG + Intergenic
948664245 2:239524759-239524781 TATCACTAAAAAATAGCGCCGGG - Intergenic
1169037030 20:2462158-2462180 TTTCCCTATAAGATAACCCATGG - Intronic
1169529977 20:6474772-6474794 TCCCCTGAAAAAATAGACCAAGG + Intergenic
1169647496 20:7829541-7829563 AGTGCCTAAAATATAGCCCAAGG + Intergenic
1170766685 20:19295423-19295445 TCCCCTTAAAAACTGGCCCAAGG - Intronic
1170992992 20:21322385-21322407 TCTCTCTAAAATATCACCCATGG + Intronic
1179608352 21:42532878-42532900 TGTCCCCAAAAACTAGCCAAGGG - Intronic
1182889215 22:33802773-33802795 TCTCCCTAAACAATACCACCAGG + Intronic
950888191 3:16378898-16378920 TCTCCCTAAAAAATAGCCCAAGG + Intronic
952271402 3:31835640-31835662 TTTCAGAAAAAAATAGCCCAAGG + Intronic
953350826 3:42214512-42214534 TCTCTCTAGAAGATACCCCAGGG + Intronic
954821879 3:53336797-53336819 TCTTCCTAAAAAATAACCATGGG - Intronic
956409303 3:68962558-68962580 TCTTCCTAAACTATGGCCCAGGG + Intergenic
958993718 3:100877053-100877075 TTTCCCTCATAAATATCCCAAGG + Intronic
959123383 3:102260177-102260199 TCTCTCAAAAAAGTAGTCCAAGG - Intronic
959249402 3:103922471-103922493 TCTCCATGAAAAACAACCCAAGG + Intergenic
960924723 3:122783124-122783146 TCTCACTGAAAAGTAGCCCCTGG + Intronic
960999184 3:123361307-123361329 TCTCCATAAAAAATAACGAAGGG - Intronic
962313873 3:134345809-134345831 TCTCCCTGAATAAAAGCCCTGGG - Intergenic
962863410 3:139425550-139425572 ACTCCCTAACAGATAGCTCAGGG + Intergenic
963417162 3:145011657-145011679 TCTTTCTATAAAATAGCCCTTGG + Intergenic
970586376 4:17518195-17518217 CCTCCCCAAAAAATCACCCAGGG + Intronic
970838492 4:20439049-20439071 TTTCCCCAAAAAATAGAGCAGGG + Intronic
972428544 4:38958442-38958464 CCACTGTAAAAAATAGCCCAAGG - Intergenic
974897439 4:67956557-67956579 TCCCCCTATAAAATAGGGCAGGG + Intronic
977571729 4:98635903-98635925 TCTCCCTAAATAATAGGGTAGGG + Intronic
978510617 4:109513573-109513595 CCTCCTTAAAAAATAGATCAGGG - Intronic
979327123 4:119393344-119393366 ACTCACTATAAAAAAGCCCAAGG + Intergenic
980483902 4:133427530-133427552 TGTCACTAGTAAATAGCCCAGGG + Intergenic
980663423 4:135897707-135897729 TCTTCTTAAAAAAGACCCCAAGG + Intergenic
981735195 4:147942287-147942309 TCTCCTCAAAAAATAGTACATGG - Intronic
983245005 4:165278032-165278054 ACTCACTATAAAAAAGCCCAAGG + Intronic
985976872 5:3426100-3426122 GCTCCTTAACAAATAGCCCCTGG - Intergenic
994431463 5:99668344-99668366 TCACGATAAAAAATAGCACATGG - Intergenic
994467044 5:100149559-100149581 TCTCACTTAAAACTATCCCATGG - Intergenic
995305008 5:110635317-110635339 TCTCCCTAACACATTTCCCAAGG + Intronic
995313096 5:110735650-110735672 TCTTCCAAAAAAATAGAACATGG + Intronic
997648527 5:135497865-135497887 CCTCCATAAAACATAGCACAGGG + Intergenic
999509213 5:152230429-152230451 TATCCCTTAAAAATAGGCTATGG + Intergenic
999715038 5:154353596-154353618 TATCCCTAAAGTCTAGCCCAAGG - Intronic
999923811 5:156352917-156352939 TCTTCATGAAAAATAGCCCTTGG - Intronic
1001738644 5:174029835-174029857 TCTGCCTAAAGAATAGCTCTTGG - Intergenic
1002998413 6:2308307-2308329 TCTCCCTAAAAAGTAAAACAGGG + Intergenic
1007268652 6:40618538-40618560 TCTCCCTACCATGTAGCCCATGG - Intergenic
1007973623 6:46077907-46077929 TCTCACTAGAAATTAGCCTATGG - Intronic
1009683336 6:66925820-66925842 TCTCCCTAAAAAATGGATCTGGG + Intergenic
1012607871 6:101181025-101181047 TCTCCAGAAAACATAGCCCGAGG + Intergenic
1013612528 6:111808325-111808347 TCCCCCTCAATACTAGCCCAGGG - Intronic
1014726494 6:124978097-124978119 TGTCCCTATAGAATAGTCCATGG + Intronic
1016796795 6:148126434-148126456 TCTACTTAAAAAATTGCCAATGG - Intergenic
1021123197 7:16820394-16820416 TCTCATTAAAAAATAGGCAAAGG - Intronic
1021301190 7:18975045-18975067 TTTCACAAAAAAATAGCCTAAGG + Intronic
1026336118 7:69395379-69395401 TCTTCCTGAAAATTAGCCCAGGG + Intergenic
1027674956 7:81145657-81145679 TATCCCTAAAATAAATCCCACGG - Intergenic
1028255695 7:88594768-88594790 TCTCAGTTAAAAAAAGCCCAGGG + Intergenic
1030515906 7:110537385-110537407 TGTCCCTATACAGTAGCCCATGG + Intergenic
1031221685 7:118974679-118974701 TCTCCCTTAAATAAATCCCATGG - Intergenic
1031476629 7:122230822-122230844 AATACCTAAAAAATAGGCCAGGG + Intergenic
1031568882 7:123333484-123333506 TCTCCCCCAAAAAAAGTCCAGGG + Intergenic
1031646347 7:124230701-124230723 TCTCCATAAAACATCCCCCAAGG - Intergenic
1031647195 7:124240711-124240733 TCTCCATAAAACATCCCCCAAGG - Intergenic
1032405938 7:131655489-131655511 TCTCCCTAAAGAACAGGCCCTGG + Intergenic
1032491901 7:132330083-132330105 ATTCCCTAAAAATCAGCCCAGGG - Intronic
1034557912 7:151861653-151861675 TCTCCCTAACAAGCCGCCCATGG - Intronic
1043197794 8:77321254-77321276 TCACCATAAAAAATTTCCCATGG - Intergenic
1044117204 8:88350153-88350175 TCTCCGTAAGAAAGATCCCAGGG - Intergenic
1044496047 8:92884569-92884591 TTTCCCCAAAAAATACCTCAAGG + Exonic
1045520722 8:102900716-102900738 TCTCCCCAAAATAAAGCACAGGG - Intronic
1046222754 8:111236838-111236860 ACTGACTAATAAATAGCCCATGG + Intergenic
1047417118 8:124673836-124673858 TCTACCTGAAAAATGGCACAAGG + Intronic
1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG + Intergenic
1052399878 9:27986957-27986979 TCTCCATAGGAAATAGCCCAAGG - Intronic
1053912404 9:42920731-42920753 TGTCCCAAAAAAAAAACCCAGGG + Intergenic
1056056266 9:82826979-82827001 TCACGCTAACAAATAGTCCATGG - Intergenic
1060304081 9:122394697-122394719 TCTCCTTAAAAACTGGCCCGTGG + Exonic
1062257187 9:135632352-135632374 TTTCACTTAAAAATATCCCAGGG - Intronic
1187141756 X:16600720-16600742 TTACCCTAAAAAATATCTCAAGG + Intronic
1187385279 X:18842858-18842880 TTTCCATAGAAAATAGTCCATGG - Intergenic
1188489994 X:30727493-30727515 ACTCACTATAAAAAAGCCCAAGG - Exonic
1189309448 X:40009401-40009423 TTTCCTTAAAAAATAGCCAAAGG - Intergenic
1189401885 X:40677314-40677336 TTTCCCAAAGAAATGGCCCAAGG + Intronic
1193022866 X:76810796-76810818 TCTCAGTAAAAGAAAGCCCAGGG + Intergenic
1195123238 X:101778927-101778949 ACTCACTATAAAAAAGCCCAAGG + Intergenic
1195274510 X:103268378-103268400 TCTCCCTAAAACATAGCAGAAGG - Intergenic
1195364969 X:104116614-104116636 TCCCCCTACAACATAGCCCAGGG - Intronic
1195756759 X:108206265-108206287 TCAACCTAAAGTATAGCCCAGGG - Intronic
1195942768 X:110179197-110179219 TCTTCCTAAAAAGGAACCCATGG - Intronic
1196363889 X:114900629-114900651 TCTCCATGCAAAATAACCCATGG + Intronic
1196659555 X:118255556-118255578 TCTTTCTCAAAAATAGCCAAAGG + Intergenic
1197249032 X:124195389-124195411 TGTCCCTAACATCTAGCCCAGGG + Intronic
1197386062 X:125803839-125803861 TCTCCCAACAAAAGAGACCATGG + Intergenic
1201532958 Y:15012422-15012444 TCTCTCTAAAAACTGGCACAAGG - Intergenic
1201849378 Y:18461214-18461236 TCTCCCCAAAAAATTACACAAGG - Intergenic
1201883940 Y:18859161-18859183 TCTCCCCAAAAAATTACACAAGG + Intergenic