ID: 950889512

View in Genome Browser
Species Human (GRCh38)
Location 3:16390960-16390982
Sequence AGGTTGTCATGGGGGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950889512 Original CRISPR AGGTTGTCATGGGGGGTACA GGG (reversed) Intronic
901128696 1:6948584-6948606 ATGTTGGCATGGTGGGGACAGGG + Intronic
903507219 1:23846085-23846107 AGGTAGTTATGGGGGATTCAAGG + Exonic
903917491 1:26774904-26774926 GCCTTGTCATGGGGGGCACAGGG - Exonic
904870899 1:33617480-33617502 AGGGTGTCAGGGGAGGTACCTGG + Exonic
905427049 1:37894338-37894360 AGACTGTGATGGGGAGTACAGGG - Intronic
907383697 1:54111657-54111679 GGGTTGTCGTGAGGGTTACATGG - Intronic
908922596 1:69213557-69213579 AGATTGTCATCTGTGGTACATGG + Intergenic
912517256 1:110224131-110224153 AGGGTGTGATGGGCAGTACATGG + Intronic
914974375 1:152346650-152346672 AGACTGTCATGGAGAGTACATGG - Intergenic
922354702 1:224764735-224764757 GGCCTGTCATGGGGGGTGCAGGG - Intergenic
1063105426 10:2987892-2987914 AGGGAGGCATGGGGGGCACAGGG - Intergenic
1063147923 10:3313321-3313343 AGCTCTTCTTGGGGGGTACATGG - Intergenic
1067224760 10:44368433-44368455 AGTCTGGCATGGGGGGCACAGGG - Intergenic
1077342272 11:2031414-2031436 GGGCTGGCATGGGGGGCACAGGG + Intergenic
1078892081 11:15566609-15566631 AGGCTGCCATGGGGCGCACAAGG + Intergenic
1079196587 11:18333062-18333084 AGGTTGCCATGGTGGCTAGAAGG - Exonic
1080803083 11:35626802-35626824 AGCTTGTCTTGGAGGGTTCAGGG + Intergenic
1082261077 11:50076620-50076642 AGCTTGGCTTGGGGGGGACACGG + Intergenic
1083893771 11:65610179-65610201 AGGTGGTCATGGAGGGCACCTGG - Intronic
1086003019 11:82002831-82002853 AAGGTGTCTTGGGGGATACATGG + Intergenic
1202825258 11_KI270721v1_random:86603-86625 GGGCTGGCATGGGGGGCACAGGG + Intergenic
1091765353 12:3116762-3116784 AGGTTGTCATGCGGACGACAGGG - Intronic
1094023797 12:25941596-25941618 AGGTTGTCCTGGGAGGTGCTGGG - Intergenic
1096013673 12:48246520-48246542 AGGTTGTCATGAGGCGCATATGG - Intergenic
1103443534 12:120979982-120980004 AGGATGGCCTGGGGGCTACAGGG + Intronic
1104820035 12:131671891-131671913 AGGTGGTCATGGGGGATTCCAGG - Intergenic
1114444256 14:22776144-22776166 AGGGTGTCTTGTGGGGTACTGGG - Intronic
1118324679 14:64772976-64772998 ATGTGGTTATGGGGGGCACAGGG + Intronic
1120516452 14:85476661-85476683 AGGATGTAATGGGAGGTACAGGG + Intergenic
1121022993 14:90593183-90593205 AGTTTGCCATGTGGGGTGCAGGG - Intronic
1121680914 14:95792019-95792041 AGGTTGTAAAGGGAGGCACAGGG + Intergenic
1126214604 15:46140393-46140415 AAGTTGTCATGGGGGGTTGAGGG + Intergenic
1130301860 15:82686183-82686205 AGGGTTTCATAGGGGGTTCAAGG + Intronic
1131588076 15:93717632-93717654 AGGTTGTCATGGGGAGAAACCGG - Intergenic
1132240571 15:100254366-100254388 AGGTTCTCATGTGGGGTAAGTGG - Intronic
1132561241 16:595250-595272 AGGTGGTGGTGGGGGCTACACGG - Intronic
1135488867 16:22890051-22890073 AGATTGTCATGAAGGATACATGG - Intronic
1137715531 16:50595999-50596021 AGGCTGTCATCGGGGGCTCAGGG - Intronic
1137793931 16:51198876-51198898 GAGTTGTCATGGGGGGAAAAGGG + Intergenic
1138136545 16:54528322-54528344 AGTTTGTCATGGTGGCCACATGG - Intergenic
1138521361 16:57573051-57573073 GGGTTGTCATGGGGATTGCAGGG + Intronic
1139390132 16:66602073-66602095 TGATTGTCATGAGTGGTACAAGG + Intergenic
1140138245 16:72227980-72228002 AGGTTACCATGGGGGCTACGGGG - Intergenic
1141196107 16:81862494-81862516 AGGTTGTCAGGGGTGGCACCAGG + Intronic
1143218807 17:5244582-5244604 ATTTTGTCATGAGCGGTACAAGG - Intergenic
1144142148 17:12360015-12360037 AGATGGGCATGGGTGGTACAAGG + Intergenic
1144579553 17:16450702-16450724 AGCTGGTCATGGGGGCTGCAGGG + Intronic
1146705289 17:34996733-34996755 AGGTTGGAAAGGAGGGTACAGGG + Intronic
1148286356 17:46396369-46396391 AGTTTGGAATGTGGGGTACATGG + Intergenic
1148308522 17:46613961-46613983 AGTTTGGAATGTGGGGTACATGG + Intronic
1148608532 17:48948064-48948086 AGGGTGGCATGGGTGGGACAAGG + Intergenic
1152744488 17:82032502-82032524 AGTGTGGCATGGGGGGGACACGG + Intronic
1158745642 18:60196541-60196563 AGGTTGCCATGGTGGCTAGAAGG - Intergenic
1159926922 18:74277812-74277834 ACGGTGTCATGGAGGATACAGGG + Intronic
1161235448 19:3196008-3196030 AGGTTGTCCTAGGGGGAGCACGG + Intronic
1165396007 19:35563812-35563834 AGGTTGACATGGGGGGATCTGGG - Intergenic
1166342615 19:42147970-42147992 AGGGTGTCATGGTGAGTCCATGG + Intronic
1166343042 19:42150199-42150221 GGGTGGTCTTGGGGGGCACAGGG - Intronic
1167006437 19:46779065-46779087 AGATTGGCATGGGGGCTTCAGGG - Intronic
926159400 2:10477075-10477097 TGGTTGTCATGGTGGGGAGAAGG + Intergenic
927697452 2:25247802-25247824 GGGTTGCCATGGGGGGATCAGGG - Intronic
932875243 2:75444427-75444449 GGGTTGTCATGGTGGTTAAATGG - Intergenic
933168948 2:79104081-79104103 AGGTTTTCATGGGGATTAAATGG - Intergenic
933476782 2:82802042-82802064 AGATTGTGATGGGGGGAAAAAGG - Intergenic
933786025 2:85842294-85842316 AGATGGTCACTGGGGGTACATGG - Intronic
935240283 2:101171921-101171943 AGGTTCTCATAGTGGGGACAAGG - Intronic
942521108 2:176805135-176805157 AGGTGGTTATGGGGGATTCAAGG + Intergenic
947213121 2:227725948-227725970 AGGTTGTGTTGGGGAGGACAGGG - Intergenic
1171934589 20:31261847-31261869 AGGTTGTTTTGGGAGGTCCACGG - Intergenic
1172223518 20:33289421-33289443 AGGTTGTCTGGGGTGGCACAGGG + Intronic
1179801517 21:43813512-43813534 AGGGTGACATGGGGGGCCCAGGG - Intergenic
1179908612 21:44436572-44436594 GGGTTGACATGGGGGTGACATGG - Intronic
1179979149 21:44887513-44887535 AGGATGGCAGGAGGGGTACAGGG - Intronic
1182269129 22:29142422-29142444 AGGTGGTCATGGCTGGCACAGGG + Intronic
950176086 3:10875735-10875757 AGGTTCTCTTAGTGGGTACATGG + Intronic
950889512 3:16390960-16390982 AGGTTGTCATGGGGGGTACAGGG - Intronic
958582676 3:96046230-96046252 AGCGTGTCATGGGAGGTACCTGG - Intergenic
962433110 3:135338526-135338548 AGGTTGTCTTGGGTGGGAGATGG - Intergenic
963310830 3:143708373-143708395 AGGTTGTCATTTGAGGTACATGG - Intronic
965449120 3:168815675-168815697 AGGTTCTCATGGGGGTCCCAAGG - Intergenic
970131458 4:12876160-12876182 ACGTTGCCATGGGGCCTACATGG - Intergenic
970313899 4:14811015-14811037 AGGTTGTCATGAGGATTAAATGG - Intergenic
978837096 4:113163985-113164007 AGGATGCCATGGGGAGGACAAGG - Intronic
986777178 5:11026782-11026804 AGGTGGTCATGGGAGGATCAAGG + Intronic
987213717 5:15710930-15710952 ACGTTGTCATGGGAGGAACCTGG + Intronic
990801713 5:59611481-59611503 AGGTTGTGATGAGTGTTACAAGG - Intronic
996858934 5:128042821-128042843 AGGTTCTCATGGGGCTTAGAAGG - Intergenic
999878190 5:155831826-155831848 AGGTTCTCCAGGGGAGTACAAGG + Intergenic
1003825229 6:9944961-9944983 AGTTTGTCATTGTGGGTACCAGG - Intronic
1006269650 6:32953951-32953973 AGGAGGTAATGGGGGGTAGAAGG + Intronic
1006393664 6:33773336-33773358 AGGCTGTCCAGGGGGGTGCAAGG - Intronic
1008435460 6:51470640-51470662 AATTTGTCATGTGTGGTACAGGG + Intergenic
1011247207 6:85331964-85331986 AAGTTTTCATGGAGGGTGCAGGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1017888391 6:158619892-158619914 AGGATGTCATGAGGGGTGCAAGG + Intronic
1019387112 7:763509-763531 AGGTGGTCCTGGGGCTTACACGG - Intronic
1022373470 7:29791299-29791321 TGGGTGTCATGAGGGGAACAGGG - Intergenic
1023842685 7:44105960-44105982 AGGGAGTCCTGGGGGGTTCAGGG - Intronic
1026681919 7:72473339-72473361 AGGTTGTCATGAGGATTAAAGGG - Intergenic
1034533017 7:151708371-151708393 AGGTTGGCATGGGGGTTTGAGGG - Intronic
1034547886 7:151800917-151800939 AGATTGGCATGGGGGCTGCAGGG + Intronic
1036064200 8:5359373-5359395 GGGTTGTCATAGGAGGAACAAGG + Intergenic
1036789211 8:11707379-11707401 AGATTGTCCTTGGGGGGACAAGG - Intronic
1039099781 8:33928714-33928736 AGGTTGTCTTGGGGGATAATAGG + Intergenic
1045755037 8:105532744-105532766 ATGATGTAATTGGGGGTACAAGG + Intronic
1049213350 8:141396676-141396698 AGGTGGGGATGGGGGCTACAGGG + Intronic
1051580452 9:18667579-18667601 AAGTTGTCATGAGGAATACATGG + Intronic
1052083919 9:24240536-24240558 AGATTGCCATGGGGGCTAGAGGG - Intergenic
1057967341 9:99517138-99517160 AAGTTGTCATTTGTGGTACAGGG - Intergenic
1059650870 9:116314800-116314822 AGGTTGTCAGGGGAGGGATATGG - Intronic
1060771669 9:126336498-126336520 AGGTTGTCATCCCGGGTTCACGG - Intronic
1186741856 X:12526585-12526607 AGGTTGGCATGGGAGGGAAAAGG - Intronic
1187089406 X:16079411-16079433 AGATTGTCATGGAGGTTAAAGGG + Intergenic
1192503835 X:71669173-71669195 AGGTTGTCATCGGGAGCCCAGGG + Intergenic
1192522597 X:71815217-71815239 AGGTTGTCATCGGGAGCCCAGGG + Intergenic
1194873634 X:99161872-99161894 AGGTTGGGATGAGGGGTGCAGGG + Intergenic
1195688590 X:107605958-107605980 AGGGTGTCATGGTGGGGGCATGG - Intergenic
1196150119 X:112364302-112364324 GGGTTCTCATGGGGAGTAGAGGG - Intergenic
1199984018 X:152937543-152937565 AGCTTGACATGGCGGGTGCACGG - Intronic
1200103591 X:153700492-153700514 AAGTTGTCATGGTGTGTACGTGG - Exonic