ID: 950890313

View in Genome Browser
Species Human (GRCh38)
Location 3:16398772-16398794
Sequence CATAACACTCTGTCATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950890313_950890320 15 Left 950890313 3:16398772-16398794 CCTTGAGATGACAGAGTGTTATG 0: 1
1: 0
2: 0
3: 9
4: 161
Right 950890320 3:16398810-16398832 TCCCTGGAACAAAGCATTCCTGG 0: 1
1: 0
2: 4
3: 14
4: 231
950890313_950890315 -1 Left 950890313 3:16398772-16398794 CCTTGAGATGACAGAGTGTTATG 0: 1
1: 0
2: 0
3: 9
4: 161
Right 950890315 3:16398794-16398816 GCCCAGGCCCAGTCTCTCCCTGG 0: 1
1: 0
2: 4
3: 57
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950890313 Original CRISPR CATAACACTCTGTCATCTCA AGG (reversed) Intronic
900824003 1:4911799-4911821 CATCTCACTCTGTCTTCACATGG + Intergenic
903280504 1:22247392-22247414 CATACCCCTCTGCCATCCCAGGG - Intergenic
905235360 1:36542637-36542659 CATGAAACTCTGTCACATCAGGG + Intergenic
905949476 1:41936715-41936737 CAAATCATTCTGTTATCTCAAGG + Intronic
906346397 1:45018120-45018142 CAGAACACTGTTCCATCTCAGGG - Exonic
909632187 1:77779239-77779261 CTTAACACTCATTCATCTGAGGG + Intergenic
910227628 1:84952257-84952279 CATAACAGTCTGGTAACTCACGG + Exonic
910649196 1:89546504-89546526 CAGAACACTCCATCAGCTCATGG + Intronic
916411885 1:164554206-164554228 TATAAGACTATATCATCTCATGG + Intergenic
918930081 1:190843655-190843677 CAGATGACTCTGTCATTTCAAGG + Intergenic
919186928 1:194163019-194163041 CTTATCACTCTGTTAACTCACGG - Intergenic
919813351 1:201422704-201422726 TATTATAGTCTGTCATCTCATGG + Intronic
921784665 1:219215656-219215678 CATAACTGTGTCTCATCTCAGGG + Intergenic
923914084 1:238483003-238483025 CAAAACACTCGGTCTTATCATGG - Intergenic
924833264 1:247620557-247620579 CATACCACACTGCCTTCTCAGGG - Intergenic
1063986809 10:11513181-11513203 AATAACATTCTGTGGTCTCAAGG + Intronic
1068715651 10:60185275-60185297 CATAACAATCTGAATTCTCAAGG - Intronic
1069512989 10:69056172-69056194 CATACCACTCTGCCTTCTCTGGG - Intergenic
1076004273 10:126935531-126935553 CATCACTCTCTGACAGCTCAAGG - Intronic
1077500402 11:2907418-2907440 CACATCACTCTGTCTTCCCATGG + Intronic
1077721469 11:4634430-4634452 CATTACACTCTTTCTTTTCATGG + Intergenic
1079252561 11:18797575-18797597 GATACCAGTCTGTCAGCTCAGGG + Intergenic
1080931392 11:36815218-36815240 CATAACACTCATACATATCATGG - Intergenic
1081473967 11:43406212-43406234 CAGAACTCTCTGTTATCTAATGG + Intronic
1084752851 11:71215353-71215375 CACGCCACTCTGTCATCTCAAGG + Intronic
1086185374 11:84008080-84008102 CACAAAACTATGTCATATCATGG + Intronic
1093078703 12:14784681-14784703 AATAATACTCTGCCATGTCATGG - Exonic
1093712282 12:22340549-22340571 CATATCATTATCTCATCTCAGGG + Intronic
1095193462 12:39285527-39285549 CATAATATTCTTTTATCTCATGG - Intergenic
1096966418 12:55631700-55631722 CATGACACTGTCTCAGCTCAGGG + Intergenic
1102614706 12:114143343-114143365 CATAAGATTCTGTCCTTTCAGGG - Intergenic
1103281072 12:119758357-119758379 CAAAACACTCTGTAATGTGATGG + Intronic
1104348420 12:128023712-128023734 CATAACATTCTGTTTTTTCAAGG - Intergenic
1105646791 13:22328510-22328532 CATCACACTTTTTCATCACATGG - Intergenic
1107428971 13:40321680-40321702 CATAAATCTCTTTCATTTCAAGG + Intergenic
1107819549 13:44273850-44273872 CATGACACACTGTCCTCTCAAGG + Intergenic
1110054873 13:70954603-70954625 CATTAGAATCTGTCATCTCTGGG + Intergenic
1114254960 14:20993862-20993884 CATAACACTCTCTTTTCCCAGGG + Intronic
1114659597 14:24335807-24335829 CAGACCACTCTCTAATCTCAGGG - Intronic
1117532869 14:56676227-56676249 GGAAACACTCAGTCATCTCAAGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122278995 14:100610252-100610274 CATACCAGTCTGTCCTCTGATGG - Intergenic
1123065553 14:105617252-105617274 CATCACACTATGTCATGCCAGGG + Intergenic
1126374118 15:47977381-47977403 CACATCCCTCTGTAATCTCATGG + Intergenic
1126528991 15:49690748-49690770 CCTAGCACTCTGCCATCTCAGGG - Intergenic
1127568570 15:60217527-60217549 TATAACAGTCTGTCTTCCCAGGG + Intergenic
1127869341 15:63057866-63057888 CAGAACGCTCTCTCACCTCATGG - Intronic
1128174736 15:65545110-65545132 CACAACACTCTTTCATCCAATGG - Intronic
1130271364 15:82451236-82451258 CATGAGATTCTGTCATTTCAAGG - Intergenic
1130463704 15:84178576-84178598 CATGAGATTCTGTCATTTCAAGG - Intronic
1130488970 15:84416211-84416233 CATGAGATTCTGTCATTTCAAGG + Intergenic
1130500562 15:84494966-84494988 CATGAGATTCTGTCATTTCAAGG + Intergenic
1130894020 15:88156886-88156908 CACAAAACTCTTTCATCTGAAGG + Intronic
1131337419 15:91562591-91562613 CATAACACTCAGTCTTTTCCAGG + Intergenic
1131677810 15:94688994-94689016 AATAACACTCTGTAATAACATGG + Intergenic
1134469519 16:14511218-14511240 CATCACCCTGTGTCAACTCATGG - Intronic
1135417556 16:22280240-22280262 CATCACAGTCCGTCATCTCCAGG - Exonic
1137438208 16:48475468-48475490 AATAACACTGTGTCTTTTCAAGG + Intergenic
1138405003 16:56785125-56785147 CCTAAAACTCTTTCATTTCAAGG - Intronic
1143226496 17:5309059-5309081 AATAACATTCTCTTATCTCAAGG - Intronic
1147904364 17:43813329-43813351 GATAACAATCTCTCTTCTCAGGG + Intronic
1148392320 17:47281425-47281447 GAAAACACTGTGTCATCTAAAGG + Intronic
1150511932 17:65762660-65762682 AATAACACTATATCATCTCATGG + Intronic
1153437227 18:5080416-5080438 CATAAGCCTCTGTCATTTCATGG - Intergenic
1154172818 18:12063397-12063419 CATAACACGCTGAGACCTCAGGG - Intergenic
1155874638 18:31070721-31070743 CTTACCACTTTGTCATCTCCAGG + Exonic
1158698246 18:59722131-59722153 CACTACAATCTGTCATCACATGG - Intergenic
1159753554 18:72334031-72334053 TATAACACATTGTCATATCAAGG - Intergenic
1164500192 19:28813049-28813071 CAAAACAACCTGTTATCTCAGGG + Intergenic
1164725746 19:30464662-30464684 GATGACACGCTGTCATCTCCAGG + Intronic
1164766137 19:30772704-30772726 TCCAACACTCTGTCATCTCCAGG + Intergenic
1167232466 19:48293678-48293700 CACAGCTCTCTGTCACCTCAAGG - Intergenic
1168532516 19:57141042-57141064 CATGACACTGTTACATCTCAGGG + Intronic
925329916 2:3050744-3050766 ACTCACACTCTTTCATCTCAAGG + Intergenic
934566073 2:95342104-95342126 CCCAGCACTCTCTCATCTCAGGG - Intronic
935549704 2:104439631-104439653 GATAACACTGTGGCATTTCAAGG - Intergenic
936725499 2:115310139-115310161 CATAACACTGTGTCATATGTGGG - Intronic
937477343 2:122227365-122227387 CATCTCACTCTGTCCTCACAGGG - Intergenic
937532413 2:122845159-122845181 CTTATCTCTCTGTCATGTCATGG + Intergenic
937594117 2:123652307-123652329 CAAAAGACACAGTCATCTCATGG + Intergenic
938273347 2:129993954-129993976 CCTAACTCTCCGTCATCTCGAGG - Intergenic
938672345 2:133598295-133598317 CATAACACACTGTAGGCTCATGG + Intergenic
939756777 2:146123385-146123407 CATAACATTCTTGCATCACATGG + Intergenic
942104312 2:172617528-172617550 TAGAACACTGTGTCATCTGAGGG + Intergenic
942669785 2:178362800-178362822 CATAAAACACTGTCAGCTGAGGG + Intronic
943062630 2:183054335-183054357 CATAACCCTCTATCTTCTCTGGG - Intergenic
943276812 2:185877404-185877426 CATAACACTCAGTTTTTTCATGG - Intergenic
945713282 2:213328560-213328582 CCAAACAGTCTGCCATCTCAGGG + Intronic
946337488 2:219048256-219048278 CCTAACCCTTTGTCATCTGAAGG - Intergenic
948002543 2:234580215-234580237 CAAAACAGTCAGTCATCACAGGG + Intergenic
1170251174 20:14284660-14284682 TAGAACACTCTGTGATCACAAGG - Intronic
1171558159 20:26096742-26096764 CCTAACACGCTGACAGCTCAGGG + Intergenic
1172135321 20:32682801-32682823 CAAAACATGCTGTCACCTCAGGG + Intergenic
1172216668 20:33240413-33240435 CATCACACCCTGTCATCTCTGGG - Intronic
1174454650 20:50640595-50640617 CCCAACCCTCTGTCATCTCGGGG + Intronic
1179422540 21:41248242-41248264 TTTAACACTCTGTGATCTGAGGG + Intronic
1184074226 22:42165886-42165908 CATATCACTCTGTCAGAACATGG + Intronic
1184908651 22:47510313-47510335 CAAAACACCATGTCATCTCTTGG - Intergenic
949981520 3:9504907-9504929 TATATCACTCTGTCATCTTCTGG + Intronic
950560875 3:13723307-13723329 CAAAAACCACTGTCATCTCAGGG - Intergenic
950890313 3:16398772-16398794 CATAACACTCTGTCATCTCAAGG - Intronic
950953204 3:17023305-17023327 GATAACACTCTGTGATCTACGGG + Intronic
953758371 3:45666824-45666846 GAAATGACTCTGTCATCTCAGGG + Intronic
954147823 3:48642927-48642949 CCTAAAACTCTGGCTTCTCAGGG + Intronic
955229211 3:57084210-57084232 CACAAGGCTCTGTTATCTCAAGG - Intergenic
956733593 3:72218554-72218576 CATAACACTCCGTCATTGCTTGG + Intergenic
957829738 3:85501445-85501467 GATAATACTATTTCATCTCAAGG - Intronic
958850560 3:99319761-99319783 CATAACTTTCTGTCATATTATGG + Intergenic
959527795 3:107397333-107397355 CATAAAACTGAGTCATCTGAAGG - Intergenic
963352535 3:144169674-144169696 CCTACCACTAAGTCATCTCAAGG - Intergenic
964320011 3:155485955-155485977 CCTACCACTTTGTCATCTCTGGG - Intronic
964472122 3:157067077-157067099 TATTACACTCTGTCATGTCAGGG - Intergenic
964641724 3:158915738-158915760 AATATGACTCTGGCATCTCAGGG + Intergenic
966890628 3:184405187-184405209 CAGAACAATCTTTCTTCTCATGG - Intronic
967161717 3:186744934-186744956 CATTACACCATGTCATCTGAAGG + Intergenic
967420713 3:189269262-189269284 CATAACAATGTGTGGTCTCAAGG + Intronic
967467149 3:189820809-189820831 TATTACATTCTGTAATCTCATGG + Intronic
969915537 4:10487713-10487735 CATAACACTGTCTCCTCTCTGGG + Exonic
970666234 4:18340598-18340620 CATAACAGTCTCTCAGATCACGG - Intergenic
971485357 4:27154460-27154482 AACAACGCTCTTTCATCTCAGGG + Intergenic
974578881 4:63768289-63768311 CTTATTACTCTGTCATCTCTAGG - Intergenic
978977865 4:114901096-114901118 CATAATACACCGTCTTCTCAAGG - Intronic
981491502 4:145345194-145345216 CTTATCACTCTGTCATCACCTGG + Intergenic
981673227 4:147311415-147311437 CATAACTCTCTTTCCTCTCTAGG + Intergenic
983757191 4:171354313-171354335 CAGAACACACTTTCTTCTCAAGG - Intergenic
984091368 4:175379127-175379149 TTTTACACTCTGACATCTCAGGG - Intergenic
988336652 5:29916358-29916380 CATAACAGTCTGTCAGACCATGG + Intergenic
991354486 5:65753796-65753818 CATGTAACTCAGTCATCTCAGGG + Intronic
995540952 5:113185826-113185848 CATGACACTCTGCAATCTTAGGG + Intronic
1000565468 5:162841415-162841437 AATTTCACTCTGTCACCTCAGGG - Intergenic
1000649609 5:163801188-163801210 AATAACACACTATCATCTGAAGG - Intergenic
1000657722 5:163901616-163901638 AATAACACTATGCCATTTCAAGG - Intergenic
1001216748 5:169863658-169863680 ATTAAGGCTCTGTCATCTCATGG - Intronic
1001441584 5:171747927-171747949 CATCTCACTGTGTCTTCTCATGG + Intergenic
1001578161 5:172778622-172778644 AATAAAAATGTGTCATCTCATGG + Intergenic
1002352301 5:178591552-178591574 CATAACCCCCGGCCATCTCAGGG - Intergenic
1004118352 6:12793707-12793729 CATAACACTCTGTTTTCCAAAGG + Intronic
1006806371 6:36792223-36792245 CAGGAGACTCTGTCTTCTCAGGG - Intronic
1007065183 6:38983397-38983419 CATATCCCTTTGTCATTTCAAGG - Intronic
1009742194 6:67759689-67759711 CATACCACTCTGCCATGTGATGG + Intergenic
1010585382 6:77652038-77652060 CATTAAACTCTGCCATGTCAAGG + Intergenic
1014350001 6:120329351-120329373 CATAACAGTCCTTGATCTCAAGG + Intergenic
1016704518 6:147091117-147091139 CAATATACTCTGTCAACTCAAGG - Intergenic
1022658925 7:32348113-32348135 CATCAGACTCCATCATCTCATGG + Intergenic
1024534117 7:50415973-50415995 GAAAACACTCTGTCATCCTAAGG + Intergenic
1024591129 7:50885243-50885265 TATAACACTCTCTGATCACAAGG + Intergenic
1025279188 7:57614584-57614606 CCTAACACTCTGACAGCCCAGGG - Intergenic
1025305543 7:57850916-57850938 CCTAACACTCTGACAGCCCAGGG + Intergenic
1026219054 7:68376126-68376148 CATTGCAATCTGTTATCTCAAGG - Intergenic
1026898208 7:74022666-74022688 CAGGACATTCTGTCATCTCCGGG - Intergenic
1030527452 7:110671709-110671731 CCTAACACTCTTTCATTTCTTGG + Intronic
1033993548 7:147317480-147317502 CATAACACTCTATTAGCTCAAGG - Intronic
1037237044 8:16732367-16732389 CTTCACACTCTGTCTTCACATGG + Intergenic
1039570912 8:38585730-38585752 CATGGCAGTCTGTCATCTGAGGG - Intergenic
1039834088 8:41242399-41242421 CAGAACACTCTGTCTTAACAAGG - Intergenic
1039978605 8:42387857-42387879 CACAACATTCTGTTATCTGAAGG - Intergenic
1041521036 8:58756570-58756592 ATTAACACTCTGTCCTCACATGG - Intergenic
1046949268 8:120004191-120004213 GAGAAAACTCTGTCATCTAATGG + Intronic
1047028463 8:120850327-120850349 CATACCACTCAGTCTTCTCTTGG + Intergenic
1047519271 8:125582001-125582023 CTAAACACTATGTCAACTCAGGG - Intergenic
1051950490 9:22625567-22625589 CATAACCCTCTGTCTTCTATGGG + Intergenic
1053493071 9:38525989-38526011 CATAACACTGTGTCCTCACATGG - Intergenic
1057104696 9:92401836-92401858 CATAATACACTGTAATCTAATGG - Intronic
1057673308 9:97114902-97114924 TATAACACTGTGTCCTCACATGG - Intergenic
1185531310 X:821125-821147 CATCACATTCTGAGATCTCATGG + Intergenic
1189882359 X:45505375-45505397 CATAACACAATGTCACCCCAGGG + Intergenic
1196120802 X:112048511-112048533 CTTAAAACTGTGGCATCTCAGGG - Intronic
1198175055 X:134146726-134146748 GTTGACACTCTGTCATCTCCTGG + Intergenic
1198831933 X:140760029-140760051 CAAAACACTATTTGATCTCAAGG + Intergenic
1199688021 X:150281536-150281558 CATCACACACTGTCATACCAAGG - Intergenic
1199746987 X:150778089-150778111 CAGAACAGTCTGTCACCACAAGG - Intronic