ID: 950891730

View in Genome Browser
Species Human (GRCh38)
Location 3:16410287-16410309
Sequence CCCTGGCGGATATAAACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950891730_950891734 24 Left 950891730 3:16410287-16410309 CCATTGGTTTATATCCGCCAGGG 0: 1
1: 0
2: 1
3: 2
4: 48
Right 950891734 3:16410334-16410356 TACACCAAACCAATAATAGCAGG 0: 1
1: 0
2: 2
3: 31
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950891730 Original CRISPR CCCTGGCGGATATAAACCAA TGG (reversed) Intronic
903350583 1:22714011-22714033 CCCTGGCCGATGGAATCCAAAGG + Intronic
904142333 1:28363438-28363460 CAATGGAGGATATAAACCAAGGG + Intergenic
916473516 1:165146403-165146425 CTCTGGCAGATATTAACCCAAGG - Intergenic
919529463 1:198698892-198698914 GCCTGGAGGATATACAACAATGG - Intronic
924151129 1:241130816-241130838 CCCTTTCAGATATAATCCAAAGG + Intronic
1074101003 10:110354918-110354940 CCCTTGCTGATTTAAACAAATGG - Intergenic
1076700557 10:132270618-132270640 GCCTGCCGGATATGAACCCATGG + Intronic
1100150829 12:91735490-91735512 CCCTGAAGTGTATAAACCAAAGG - Intergenic
1102315784 12:111886224-111886246 GCCTGGTGAATATAAACTAAGGG + Intronic
1118985662 14:70752647-70752669 TCCTGGAGAATAAAAACCAAAGG + Intronic
1125479227 15:40069210-40069232 CCCTGGAGTAAATAAACCACCGG + Intergenic
1125588919 15:40842908-40842930 CACTGGTGGATATACAACAATGG - Intergenic
1129458451 15:75688090-75688112 CCCTGGCGGGTAGCAACAAATGG + Exonic
1129679397 15:77649671-77649693 AGCTGGAGGATAGAAACCAAGGG + Intronic
1129725337 15:77898780-77898802 CCCTGGCGGGTAGCAACAAATGG - Intergenic
1139896094 16:70289149-70289171 CCCTAGGGGATTAAAACCAAGGG + Intronic
1145936753 17:28718570-28718592 CCCTGGGGGATAGATTCCAATGG - Intergenic
1166056375 19:40291880-40291902 CCATGTGGAATATAAACCAAAGG + Intergenic
1167736529 19:51297673-51297695 CCCTGATGGATATAAACAAGAGG - Intergenic
933978131 2:87528273-87528295 CCCTCTCGGATATAAAATAATGG - Intergenic
936315703 2:111422530-111422552 CCCTCTCGGATATAAAATAATGG + Intergenic
939097783 2:137854758-137854780 CCCTTGTGGTTATAAACCACTGG + Intergenic
943852080 2:192736434-192736456 GCCTGGAGAATATAAACCACAGG + Intergenic
946861442 2:224003355-224003377 CCCTGGAGGATTTCAAACAAGGG + Intronic
1171439250 20:25147784-25147806 CCTTGGGGGAGATAAACCCATGG - Intergenic
950891730 3:16410287-16410309 CCCTGGCGGATATAAACCAATGG - Intronic
951188645 3:19743637-19743659 CCCTTGTGGAATTAAACCAAGGG + Intergenic
959383600 3:105673668-105673690 CACTGGAGGATTTAAACCAATGG - Intronic
960884889 3:122383972-122383994 CCCTAGCGGATATGTACCCATGG - Intergenic
962420498 3:135224999-135225021 CCCAGACAGATATAAATCAAAGG - Intronic
962676398 3:137761571-137761593 CCCTGACGGGTCTAAACCACCGG - Intergenic
964780603 3:160332853-160332875 CCCTGGGGTATATATATCAAAGG + Intronic
969136959 4:5037149-5037171 CCCTAGTGGATAGAAACCAGGGG - Intergenic
979033352 4:115679671-115679693 CCCTGAAGGATGTCAACCAATGG - Intergenic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
989645755 5:43630984-43631006 ACCTGGCTAATATAAACCCAAGG + Intronic
996903896 5:128575863-128575885 CCCTGCAGGATATAGACCAGGGG + Intronic
999510174 5:152241825-152241847 CCCTGGGGGATTTAATTCAATGG + Intergenic
1003794151 6:9581296-9581318 CTCTGGTTGTTATAAACCAAGGG + Intergenic
1009282294 6:61768336-61768358 ACCAGGCAGATATAACCCAAAGG - Intronic
1011684657 6:89814777-89814799 CCCTGGCGGAGATCTCCCAATGG - Intronic
1017342501 6:153341848-153341870 CCCTGACTGATACAAAGCAATGG + Intergenic
1020330486 7:7012359-7012381 CCCTGTCGTATTTAAACTAAGGG + Intergenic
1021269642 7:18570050-18570072 CTCTGTCTGATATAACCCAATGG + Intronic
1021855711 7:24853334-24853356 CCCTGGCTGGCATACACCAAAGG - Intronic
1025561886 7:62380296-62380318 CCCCGGCGGGTAAAAACCCACGG - Intergenic
1026592931 7:71712218-71712240 CCCTGGCGGAGAGACAGCAAGGG + Exonic
1029790800 7:102841079-102841101 CCTTGCCTGACATAAACCAAGGG - Intronic
1050261195 9:3842548-3842570 CCCAGTCGGAGATAACCCAAAGG - Intronic
1058682335 9:107450937-107450959 CTCTGTTGGATATATACCAAAGG + Intergenic
1062241805 9:135544970-135544992 CCCTGGGGGCTATAAAGAAAGGG - Intergenic
1200837816 Y:7750098-7750120 GCCTGGCAGATATAAACCAATGG - Intergenic