ID: 950892364

View in Genome Browser
Species Human (GRCh38)
Location 3:16415278-16415300
Sequence TGCCAGAACTATCATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950892356_950892364 18 Left 950892356 3:16415237-16415259 CCAAGGATCTTTGCCTTAGCAAC 0: 1
1: 0
2: 3
3: 23
4: 162
Right 950892364 3:16415278-16415300 TGCCAGAACTATCATGGGGAAGG 0: 1
1: 1
2: 1
3: 8
4: 119
950892360_950892364 5 Left 950892360 3:16415250-16415272 CCTTAGCAACTGGGAGAATGGAT 0: 1
1: 0
2: 4
3: 30
4: 272
Right 950892364 3:16415278-16415300 TGCCAGAACTATCATGGGGAAGG 0: 1
1: 1
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950892364 Original CRISPR TGCCAGAACTATCATGGGGA AGG Intronic
900562706 1:3315380-3315402 TGCCTGAATTATTATTGGGAGGG + Intronic
902118841 1:14144337-14144359 TTCCAGAACTTTCCTAGGGAAGG + Intergenic
905150642 1:35924460-35924482 TGCCAGCAGTATTGTGGGGAGGG + Exonic
905537731 1:38736427-38736449 TGCCACACCTACAATGGGGAAGG - Intergenic
906185341 1:43858287-43858309 TGCCTGAACTATGCTGGGAAAGG + Intronic
907571142 1:55485133-55485155 TGCCAGAAGTGTGCTGGGGAAGG - Intergenic
908580055 1:65505587-65505609 TGCCAGAACCATGATGAAGAAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912748942 1:112269551-112269573 GGCCAGGACTTTTATGGGGAAGG - Intergenic
913256014 1:116954245-116954267 TGGCAGAACCATTATGAGGATGG - Intronic
917860912 1:179143002-179143024 TGCCATAACTATTAGGTGGAAGG + Intronic
920693287 1:208163169-208163191 TGGCAGAAGTGGCATGGGGAAGG + Intronic
920975193 1:210779399-210779421 TGGGAGAACTGTCAAGGGGAAGG + Intronic
921991259 1:221370293-221370315 TGGCAGCACTGTCAGGGGGATGG - Intergenic
922066835 1:222152331-222152353 TGTCACTACTATCATGGGAATGG + Intergenic
923706975 1:236351958-236351980 TCCCAGAACTGTCATGGCGCTGG + Intronic
1067162473 10:43838879-43838901 TGCCAGATCCTTCCTGGGGACGG - Intergenic
1069898129 10:71691580-71691602 TCCCAGAATCATCATGTGGAAGG - Intronic
1069956098 10:72052881-72052903 TGTCATAACTACCATGGAGATGG - Intergenic
1071414985 10:85432927-85432949 AGCCAGATCTATGATGGGGTGGG + Intergenic
1073965723 10:108987437-108987459 GGACAGAACTATCAGGGTGATGG - Intergenic
1074895206 10:117771421-117771443 TGCCAGCATTCTCAGGGGGAAGG + Intergenic
1079522053 11:21339787-21339809 TGCCAGAGCTAGCATGATGAAGG - Intronic
1086810709 11:91306903-91306925 TAGCATAAATATCATGGGGAAGG + Intergenic
1088949427 11:114551869-114551891 TGACAGTACTAACATGGGCATGG - Intronic
1089688137 11:120169802-120169824 TTCCAGATCCATCATGAGGATGG - Exonic
1089766509 11:120771258-120771280 TGCCTGAAATTTCATTGGGATGG - Intronic
1089973625 11:122713965-122713987 TCACAGAACTATCAGGGGCATGG + Intronic
1090031116 11:123207238-123207260 TGCCAGATCTAACATGGGGAGGG + Intergenic
1097743237 12:63270122-63270144 GGCCAGAACTTCCATGGGCAAGG - Intergenic
1099907073 12:88784249-88784271 TGCCAGAAGTTCCATGTGGATGG + Intergenic
1103906017 12:124327574-124327596 TGCCAGCACCAACATGGGGCTGG - Exonic
1106026648 13:25961416-25961438 TGGCAGGACCATCAGGGGGACGG - Intronic
1106310158 13:28547175-28547197 TGCCATAGCTACTATGGGGAAGG + Intergenic
1109153526 13:58874521-58874543 CCCCAGAACTGTCATGGGGTGGG + Intergenic
1113659101 13:112092571-112092593 TTCCAGAACTGGCATGGGGCTGG - Intergenic
1115078970 14:29427430-29427452 AGCCAAAACTATCAATGGGAAGG - Intergenic
1121199448 14:92105639-92105661 TGCCAAAGCTGTCCTGGGGAAGG + Intronic
1123887974 15:24747043-24747065 TCCAAAAACTATCCTGGGGAAGG + Intergenic
1132224302 15:100128576-100128598 AGCCACGACTATCATGGCGAGGG + Intronic
1132853714 16:2035686-2035708 TGCCAGAGGTAACATGGGGCAGG + Intronic
1137629942 16:49936074-49936096 AGTCAGGGCTATCATGGGGAGGG + Intergenic
1140522590 16:75594532-75594554 TGCTAGAACCATCAGGTGGAAGG + Intergenic
1141400584 16:83743779-83743801 TGTTGGAACAATCATGGGGATGG - Intronic
1144767131 17:17738936-17738958 TGCCCGTAGTATCCTGGGGAAGG + Intronic
1153924599 18:9824981-9825003 GACCAGAACATTCATGGGGAGGG - Intronic
1158474040 18:57764140-57764162 TGCCAGATGGATCGTGGGGAAGG - Intronic
1158513948 18:58115554-58115576 TTCCAGAACTCTGGTGGGGAAGG + Intronic
1159393792 18:67830376-67830398 TGCCAGATATATGATGGAGAAGG + Intergenic
1168629724 19:57947389-57947411 TGCTAGGACTAGCGTGGGGAGGG + Intronic
929052182 2:37847277-37847299 TGCCTGAACTATCAGAAGGATGG - Intergenic
932582733 2:73002879-73002901 TGCCAGAGATCACATGGGGATGG - Intronic
933862783 2:86486869-86486891 TGGCAGAACTATCTTGGGCATGG - Intronic
934707980 2:96498006-96498028 TGCCAGAACTATCCTTCTGATGG - Exonic
940836775 2:158530683-158530705 TGCCACAACCAACATGGGGCAGG - Intronic
1171380951 20:24733779-24733801 TGCCAAAGCTATCCTGTGGAAGG - Intergenic
1172621694 20:36321694-36321716 TGGGAGAACGAGCATGGGGAGGG + Intronic
1173121757 20:40298092-40298114 TGCCAGAATTTTGATTGGGATGG - Intergenic
1175047546 20:56121432-56121454 TCCCAGAAGTATTATGGTGAAGG - Intergenic
1178365742 21:31987502-31987524 GGCCAGAACTATAGTGGGAAAGG + Intronic
1179509288 21:41861849-41861871 TGCCAGAAATAACAAGGGGAGGG + Intronic
1180053405 21:45344263-45344285 TGCCAGGACTGTGATGAGGAGGG + Intergenic
1180121699 21:45755225-45755247 TCTCAGAAGTATCATGGGCAAGG - Intronic
1181078866 22:20400851-20400873 TGCCAGATATATCATGGGGTGGG + Intronic
1182050244 22:27307540-27307562 TGAAAGAACTATCAGGGGAAAGG - Intergenic
1183738157 22:39655221-39655243 TGCCATTATTATGATGGGGATGG + Intronic
1184186520 22:42868730-42868752 TGCCAGATCTCTCACGGGGGGGG + Intronic
950892364 3:16415278-16415300 TGCCAGAACTATCATGGGGAAGG + Intronic
952303642 3:32126330-32126352 TTCCAGTAAGATCATGGGGAGGG + Intronic
954564721 3:51589902-51589924 AGCCAGAACACTCATAGGGAAGG + Intronic
954639575 3:52089946-52089968 TTCCAGGACTACCATGGGGGTGG + Intronic
954733909 3:52688975-52688997 TGCCAGTACTCTCTTGTGGAAGG + Intronic
960743071 3:120856191-120856213 AGCCAAAACTAGGATGGGGATGG - Intergenic
960992889 3:123323272-123323294 AGTCAGGACTGTCATGGGGAAGG - Intronic
961365822 3:126398601-126398623 AGCCAGAACTGGCAGGGGGAAGG - Intronic
964320813 3:155495248-155495270 TGCCAGCACAATCATCAGGAGGG + Intronic
967334328 3:188325495-188325517 TGACAGAAGAATGATGGGGAGGG - Intronic
967671601 3:192242358-192242380 TGCTAGAACTAGGAAGGGGAGGG - Intronic
968007034 3:195250074-195250096 TGCCAGAGCTAGCAGGAGGAGGG - Intronic
969318790 4:6397656-6397678 TGCCAGACCTACCAGGGGCAAGG + Intronic
970815504 4:20151436-20151458 TGGCAGAAGTACTATGGGGATGG - Intergenic
973632296 4:52830833-52830855 TGGCAGAACTTAGATGGGGAGGG + Intergenic
974193638 4:58540570-58540592 TGCCAGGACCATGACGGGGAGGG + Intergenic
974878675 4:67727492-67727514 GCCCAGAACTCTCATGGAGATGG + Intergenic
982005546 4:151059460-151059482 TGCCATTACTAAGATGGGGAAGG + Intergenic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
982665091 4:158251668-158251690 TCCCAGAACTGTCATGGTGCTGG - Intronic
985950978 5:3221094-3221116 TGACAGAGCTATCATGCGGAAGG - Intergenic
986259740 5:6133973-6133995 ACCCAGAACCACCATGGGGAAGG + Intergenic
990102120 5:52203599-52203621 TGCCAGAACTTTGATGTGAATGG + Intergenic
990974904 5:61551138-61551160 TGCCATAACTATTATGATGATGG - Intergenic
992779595 5:80116040-80116062 TGAGAGAACCATGATGGGGAAGG + Intronic
994148951 5:96426007-96426029 TGCCTGAACTCTGATGGGAAGGG - Intronic
997435134 5:133868343-133868365 GGCCAGTACCATCCTGGGGAAGG + Intergenic
998036297 5:138919944-138919966 TGCCAAAGCTACCATGGGTAAGG - Intronic
998876076 5:146600681-146600703 TGCCAGATCTATGATGGGACGGG - Intronic
999183710 5:149689752-149689774 TGTCAGAACTAAGATGGAGAAGG + Intergenic
1001947023 5:175787740-175787762 TCCCATCACTGTCATGGGGAGGG - Intergenic
1002758753 6:185461-185483 TGCCTGGAGGATCATGGGGAGGG - Intergenic
1004417977 6:15442181-15442203 TGCCAGAACTCTCCTGGCAATGG - Intronic
1005310541 6:24554997-24555019 AGCCAGAACTTTCAGGGGTAGGG - Intronic
1010768859 6:79805850-79805872 TGTCAGAACTGTCATGGGGTAGG + Intergenic
1011712890 6:90072566-90072588 TGCGTGAATTATCATGTGGAGGG - Intronic
1014271134 6:119337526-119337548 TTCCAGAACTATCATATTGAGGG - Intronic
1015698784 6:136011683-136011705 TGCCTGAACTAACATGGGGCAGG + Intronic
1019888325 7:3924690-3924712 TGCCAGAACTCTCTGAGGGATGG - Intronic
1027528185 7:79297440-79297462 TGTGAGAACTATCATCGAGAAGG + Intronic
1027558185 7:79692601-79692623 TAACAGAAGTATCCTGGGGAAGG + Intergenic
1029411167 7:100412049-100412071 TGCCAGTAAAATCAGGGGGAGGG - Intronic
1030194631 7:106841513-106841535 TTCCAGGACTATAATGGTGATGG - Intergenic
1032572129 7:133011593-133011615 GGCCAGAAGTCCCATGGGGAAGG + Intronic
1033636176 7:143213414-143213436 TGCCAAAACTATCTGGAGGAAGG - Intergenic
1037193287 8:16153789-16153811 TGCCAGAACTACCATTGTCAAGG - Intronic
1041831428 8:62159245-62159267 TGGTAGAAATATCATGGGTAGGG - Intergenic
1042005128 8:64171197-64171219 AGCCAGTACTATCCTGGGGATGG + Intergenic
1045660411 8:104431544-104431566 TGCAAGAACTAAAAAGGGGAAGG + Intronic
1046739213 8:117810897-117810919 TGCCAGAACTCTAATGGCAAAGG - Intronic
1046749382 8:117910967-117910989 TGCCAGAAGGATCAAGGTGAAGG + Intronic
1047178768 8:122567441-122567463 TACCCCAACTAACATGGGGAGGG - Intergenic
1049140029 8:140945812-140945834 TGCCAGAAAAAGCATGGAGATGG - Intronic
1054830528 9:69620126-69620148 TGCCAGATCTAACGTGGTGAGGG - Intronic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1058798280 9:108519373-108519395 TGAGAGAACCATCAAGGGGAAGG - Intergenic
1186595090 X:10972518-10972540 TGCCAGAAGTCTCCTGGGGTGGG + Intergenic
1187165532 X:16800944-16800966 CGCTAGAACTATCAGGGGGATGG - Intronic
1188884602 X:35533603-35533625 TGCCAGAACTATTATTGTGTGGG - Intergenic
1189046259 X:37594707-37594729 TGAGAGAACTTTCATGGGAATGG + Intronic
1193173421 X:78363395-78363417 TGCCAGAACTTGCATGGAGCTGG + Intergenic
1197166914 X:123387964-123387986 TTCCAAAAATATCAAGGGGAGGG - Intronic
1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG + Intergenic