ID: 950893050

View in Genome Browser
Species Human (GRCh38)
Location 3:16422245-16422267
Sequence CAATTTCAACAGAGTTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950893050 Original CRISPR CAATTTCAACAGAGTTTACC AGG Intronic
900828552 1:4947118-4947140 CAATTTCAACAGGGGAAACCCGG + Intergenic
900856749 1:5191693-5191715 CTACTTGAAAAGAGTTTACCAGG + Intergenic
901385210 1:8903696-8903718 CAATTTCAACACTATCTACCTGG - Intergenic
905582542 1:39093221-39093243 CAATTACAACACTGTCTACCTGG + Intronic
906396180 1:45467323-45467345 TAATTTCAAAAAAGTTTAACAGG + Intronic
906467984 1:46101749-46101771 GAAGTTGAACAGAATTTACCAGG + Intronic
909678960 1:78269753-78269775 CAATTTAATCAAAGTTTTCCAGG + Intergenic
909801458 1:79814501-79814523 CAATGTCAACAGAGATTAATAGG + Intergenic
910681913 1:89875143-89875165 CAATTCCAAAAGATTCTACCGGG - Intronic
913482336 1:119300717-119300739 CTATTCCAACAGAGTTTCCTGGG - Intergenic
913608540 1:120489102-120489124 GAATTTCAACAGAGTTGGTCTGG + Intergenic
914582662 1:149032736-149032758 GAATTTCAACAGAGTTGGTCTGG - Exonic
915609100 1:156976711-156976733 AAAAGTCAACAGAGTTTATCTGG - Intronic
916240788 1:162637040-162637062 AAATTATGACAGAGTTTACCAGG - Intronic
919415396 1:197301925-197301947 CTATTTCGACAGTGTTCACCAGG - Intronic
919550021 1:198974194-198974216 CAAGTTCAATACATTTTACCAGG + Intergenic
920913162 1:210236047-210236069 CAATTTCATGAGAGTCTTCCAGG + Intronic
920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG + Intronic
922805249 1:228383325-228383347 CAATTCCAACACTGTCTACCTGG + Intergenic
923861604 1:237897394-237897416 CAATTTCAAAACAGCTTACAAGG - Intergenic
1067253223 10:44607466-44607488 CAATTTCAAAAGACTTTAGATGG + Intergenic
1069007865 10:63338093-63338115 CTATTTCTAAAGAGTTTATCTGG + Intronic
1071959675 10:90798099-90798121 AAATTTCAACAGAGTTTTGGAGG + Intronic
1074701758 10:116098483-116098505 TAATTTCAAAAGAATTTTCCTGG + Intronic
1076859725 10:133135129-133135151 CATTTTAAACAGTGTTTACCAGG - Intergenic
1077520762 11:3032484-3032506 CATTTCCAACACAGTTTGCCAGG - Intronic
1090919094 11:131192542-131192564 CATTTTCAACAGAGTAAAGCAGG - Intergenic
1092923592 12:13254344-13254366 CAAATTTAACAGAGTTTAATTGG + Intergenic
1093237795 12:16632663-16632685 CAATATCAACATAGTTAACCAGG - Intergenic
1095526669 12:43134417-43134439 CAATTTCCAGAGACTTTACATGG - Intergenic
1097585011 12:61504806-61504828 CAAGGATAACAGAGTTTACCTGG - Intergenic
1097649448 12:62278684-62278706 CAATTTCTAATGAGTTTAGCAGG - Intronic
1100401777 12:94237028-94237050 CAGTTTCAATAGACTTTATCAGG - Intronic
1100627732 12:96353579-96353601 AAATGTCAACAGAGTTTAAAAGG + Intronic
1100836602 12:98572598-98572620 CAATTCCAACATCATTTACCTGG + Intergenic
1100976065 12:100123774-100123796 CAATTTACACAGAGTTTGTCTGG + Intronic
1105815068 13:24027948-24027970 CAATTTCATCACAGTTTTTCTGG - Intronic
1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG + Intronic
1106835635 13:33631955-33631977 AAATTTAAATAGAGTTTATCAGG + Intergenic
1107230178 13:38099414-38099436 AAATTTAACCAGAGTTTTCCTGG - Intergenic
1108866988 13:54936464-54936486 CAATTCCAACACTGTATACCCGG + Intergenic
1109683091 13:65778656-65778678 CATTTTTAACTGTGTTTACCTGG + Intergenic
1110336373 13:74336064-74336086 CAATTTTAACAGAATTTTCCTGG + Intergenic
1111119982 13:83834198-83834220 TATTTTGAACTGAGTTTACCTGG + Intergenic
1111404287 13:87782110-87782132 CAAATTTAACAGAGTTTATTTGG - Intergenic
1111509379 13:89241560-89241582 CAATTCCAACACTGTCTACCTGG + Intergenic
1111511384 13:89268306-89268328 CCATTTCAGCAGGGTGTACCTGG - Intergenic
1111842694 13:93470749-93470771 CAATTTCCATATAGTTTAACTGG - Intronic
1112592424 13:100776033-100776055 CAATTCCAACACTGTTTACCTGG + Intergenic
1113139337 13:107129569-107129591 AAATCTCAACAGAATTTACATGG - Intergenic
1116267744 14:42716873-42716895 CAATTTAAACTGTGTTTATCAGG - Intergenic
1116987053 14:51231738-51231760 CAATTTCCACAGACTTTAGATGG - Intergenic
1119958829 14:78831595-78831617 CAATTTTAGCAGAGTTTTCATGG + Intronic
1120465087 14:84846206-84846228 CAATCTGAACAGAGTTTACAAGG - Intergenic
1120798646 14:88665318-88665340 CAATTTCAATGGATCTTACCAGG + Exonic
1124127354 15:26948158-26948180 CACTTTCAACTTAGTTTACTGGG + Exonic
1125120338 15:36150358-36150380 TAATTTCAACAGAGTTTTTGTGG - Intergenic
1126988548 15:54343452-54343474 CAATCTTACCAGACTTTACCAGG + Intronic
1127619252 15:60717122-60717144 CAATTCTAACACTGTTTACCTGG - Intronic
1129478755 15:75806714-75806736 CTAGTTCAAAAGAGTCTACCAGG - Intergenic
1130722095 15:86398214-86398236 CCATTTCAACAGAGCTCACCAGG - Intronic
1132273951 15:100550135-100550157 TAATTTTAAAATAGTTTACCTGG - Intergenic
1134114265 16:11536253-11536275 CAATTCCGAAAGCGTTTACCTGG - Intergenic
1137643352 16:50053315-50053337 CAATATTAAGTGAGTTTACCTGG + Intergenic
1139260041 16:65582791-65582813 CAATTTCCACACTGTCTACCTGG - Intergenic
1143195674 17:5074602-5074624 CAATTTCAACAGAGTCTATGTGG + Intergenic
1149334252 17:55619114-55619136 GACTTTCAACATAGTCTACCTGG - Intergenic
1153415147 18:4838225-4838247 CAATTCCAACACTGTCTACCTGG + Intergenic
1154383148 18:13870375-13870397 CATTTTCAGCAGAGGTTATCAGG + Intergenic
1155639616 18:27998099-27998121 GAATTTGAACAGAGTTGGCCAGG - Intronic
1157452432 18:47798904-47798926 CAATCTGAAAAGAGTTTCCCTGG + Intergenic
1157807322 18:50667864-50667886 CAATTCCAACACTATTTACCTGG + Intronic
1158406367 18:57163268-57163290 CAATTTGAACAGAGGTTAGCAGG - Intergenic
1159970114 18:74639851-74639873 CAATTTCAACAAAGTATTCTTGG + Intronic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
1168516248 19:57012551-57012573 CATTTTCAACAGAGTCTTCAAGG + Intergenic
926454423 2:13047257-13047279 CAATTTCAAGAATGTTTACGAGG + Intergenic
927499527 2:23573486-23573508 CAATTTCACCAGGGTTGTCCTGG - Intronic
928142977 2:28746512-28746534 CAATTATAACAGAGTTTATGGGG - Intergenic
932128412 2:69166189-69166211 CAATTTGATCAGATTCTACCTGG + Intronic
934106050 2:88695362-88695384 CAATTTCAACACTCTCTACCTGG - Intronic
936967826 2:118144434-118144456 CATTTTCTAAAGAATTTACCTGG - Intergenic
938984996 2:136566534-136566556 GAATTTAAACACAGTTTATCTGG - Intergenic
943513363 2:188854150-188854172 CAATTTCAACAGAGTTTTAATGG - Intergenic
946920507 2:224576369-224576391 CAATTTCAACTCATTTTTCCAGG + Intronic
947537706 2:230951231-230951253 CAATTCCAACACTGTCTACCTGG - Intronic
1169436373 20:5595725-5595747 CCTTTTCAACAGAGGTTTCCAGG + Intronic
1170064439 20:12295250-12295272 TAATTTCACCAGAGAGTACCTGG + Intergenic
1170762787 20:19265493-19265515 GGATTTCAACAGACTTTACATGG + Intronic
1173239461 20:41281179-41281201 CAATTTCTACAAAGTTTAAAAGG + Intronic
1177424351 21:20903318-20903340 CAATGACAACAGAGTTTTCAAGG - Intergenic
1177557743 21:22714323-22714345 CAATTCCAACACTGTCTACCTGG - Intergenic
1177613776 21:23490021-23490043 AAATTTCAACAGAAATTTCCTGG + Intergenic
1179274622 21:39880850-39880872 CAATTTAAACATTGTTTTCCAGG - Intronic
1179537892 21:42063929-42063951 CAGTTTCAGCAGAGTTTATTTGG + Intronic
1181955426 22:26584862-26584884 CAATATCAACAGGGCTTACTGGG - Intronic
1183492408 22:38123598-38123620 TAATTCCAACAGACTTTATCAGG - Intronic
1183923406 22:41187465-41187487 AAAGTTCAACAGAGTTGGCCGGG + Intergenic
1184860221 22:47169259-47169281 CAACTTCAACAGGGGTTGCCTGG + Intronic
949623965 3:5847762-5847784 CAATATCAACAGAGCTTTCCAGG + Intergenic
949881736 3:8666698-8666720 CAATTCCAACACGATTTACCCGG + Intronic
950818533 3:15732733-15732755 CGTTTTCAACAGAATTTTCCTGG - Intronic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
950974946 3:17230557-17230579 GAATATCAACAGTGGTTACCTGG + Intronic
952648084 3:35686368-35686390 CAACTTCAACACATTTTTCCTGG - Intronic
952983432 3:38756730-38756752 CAATTTCATCAGTGGTTGCCTGG + Exonic
954103059 3:48392653-48392675 CAATTAAAACAGAGTATCCCTGG - Intronic
954854452 3:53631293-53631315 TCATTTCAACAGTGTTCACCAGG + Intronic
955717386 3:61844850-61844872 CAATTTCATCAGACTTTAAAGGG + Intronic
957526753 3:81387893-81387915 CAATTTCATCACAGTTCTCCAGG + Intergenic
960367264 3:116787749-116787771 GAATTTCAACACAGTTTATAAGG - Intronic
963391673 3:144672918-144672940 CATTTTCAATATAGTTTGCCTGG - Intergenic
964065214 3:152569833-152569855 TAATTTCAACAGTGTCTCCCTGG + Intergenic
966477458 3:180366733-180366755 CTATTTCAACAGAGCCTAACTGG - Intergenic
966584324 3:181604651-181604673 AGATTTCATCAGAATTTACCTGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970540734 4:17076290-17076312 CAATTTCAACAGAATTTTTTGGG - Intergenic
970639195 4:18044989-18045011 AAACTTCAGCACAGTTTACCTGG - Intergenic
971087384 4:23294638-23294660 TAATTTGAGCAGAGTTTAACAGG - Intergenic
971670442 4:29548352-29548374 CAATTTCAACTAACTTTATCTGG - Intergenic
971939018 4:33189775-33189797 CTATGTCTACTGAGTTTACCTGG - Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
974674244 4:65070148-65070170 CAATTACAACAGAATTTAAATGG - Intergenic
976536997 4:86229094-86229116 AAATTTCAACAGAGTGTTGCTGG - Intronic
976659220 4:87521824-87521846 CAAATTCAACAGAAGATACCTGG - Intronic
976668398 4:87625056-87625078 TAAGTTTAACAGAGTTTAACTGG - Intergenic
977533816 4:98232697-98232719 CAAGTTCAACAGAGCTTAAAGGG + Intergenic
980543222 4:134222429-134222451 CAATTTCAACAGAGTGAATTGGG - Intergenic
982176330 4:152708804-152708826 TAATTTCAAGAGACTTTACGTGG + Intronic
983667622 4:170199509-170199531 CAATTTCATCTAAGTTTACCTGG - Intergenic
983935921 4:173502539-173502561 CAAGTTTAAGAGATTTTACCAGG + Intergenic
984048005 4:174826695-174826717 AAATTTCAAAACAGCTTACCAGG - Intronic
984724528 4:183008199-183008221 CAATGGCTACAGAGTTTAACGGG + Intergenic
984842771 4:184083301-184083323 CACTTTCAGCAGGGTTAACCAGG - Intergenic
990895631 5:60697741-60697763 CAGTTTCACCAGAATTTCCCAGG - Intronic
992146875 5:73859415-73859437 CATTTTCAACAAAGTTTATGAGG - Intronic
992167959 5:74073628-74073650 CAATTTCCAGAGAGTTTAAATGG + Intergenic
993810499 5:92470438-92470460 CAATTCCAACACAATCTACCTGG + Intergenic
996653245 5:125908184-125908206 CATTTTCAACAAAGTTGCCCAGG - Intergenic
997080053 5:130727159-130727181 CAATTTCAACAGTCTCTACCTGG - Intergenic
1000371773 5:160543493-160543515 TAATTTCTACATAATTTACCTGG + Intergenic
1000663357 5:163963729-163963751 CAATGTCTCCAGAGTTTAGCAGG + Intergenic
1001163348 5:169340849-169340871 AAATATCAACAGAGTTTGGCTGG - Intergenic
1001582698 5:172809709-172809731 CAATTTCAACACTATCTACCTGG - Intergenic
1003201868 6:3968843-3968865 TAAATTTAACAGAGTTTAACTGG - Intergenic
1005152905 6:22772926-22772948 CAATTCCAACACCGTCTACCGGG - Intergenic
1005879565 6:30045507-30045529 CAATGTCAACACTGTCTACCTGG + Intergenic
1006666585 6:35699029-35699051 CAATTTGAACAGAATTTGGCAGG + Intronic
1007108271 6:39298060-39298082 AAATCTTTACAGAGTTTACCTGG - Intergenic
1007108405 6:39298792-39298814 AAATCTTTACAGAGTTTACCTGG + Intergenic
1007674795 6:43584612-43584634 CAATTCCAACACTGTCTACCTGG + Intronic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1010493104 6:76498000-76498022 GAATTTTCACTGAGTTTACCAGG + Intergenic
1011644029 6:89440937-89440959 TAGTTTCCACAGAGATTACCTGG + Intronic
1012002925 6:93676813-93676835 GAAATTAAACAGAGTTTCCCAGG + Intergenic
1015159266 6:130133849-130133871 GAATTTATACAGAGCTTACCTGG + Exonic
1018883498 6:167909881-167909903 CAACTTTAACAGAGATAACCAGG - Intronic
1021553335 7:21895139-21895161 CAATTTCATTTGAGTTTACTTGG + Intronic
1024528518 7:50371162-50371184 CATTTTCAACAGAATTCAGCAGG + Intronic
1027597746 7:80196680-80196702 TAATTTCAGCAGTGTTTTCCTGG + Intronic
1027810252 7:82887697-82887719 CATTTTCACCAGAATTTACCAGG + Intronic
1031316708 7:120267667-120267689 CAATTTGTACAGAGGTCACCAGG + Intergenic
1031479188 7:122257662-122257684 CAATTGCAACATCGTCTACCTGG - Intergenic
1031716438 7:125114417-125114439 CAATTCCCTGAGAGTTTACCGGG - Intergenic
1034107193 7:148500548-148500570 CTTTTTCAGCAGAGTTTTCCTGG - Intergenic
1036030683 8:4968422-4968444 CTATTTCAATAGTGGTTACCAGG - Intronic
1036098225 8:5748912-5748934 CAGTTTCAGTAGAGTTTAACTGG - Intergenic
1036950925 8:13138464-13138486 CAATTTCCAAAGAGATTGCCTGG - Intronic
1038909632 8:31948499-31948521 CAATTTCAACAGCATTTGGCAGG - Intronic
1041588856 8:59552239-59552261 AAATCACAACAGGGTTTACCAGG - Intergenic
1042345444 8:67722153-67722175 CAAATTTAACAGAGTTTAAATGG - Intronic
1042882742 8:73511986-73512008 CATTTTCAACAGAGGGTACTGGG - Intronic
1045465416 8:102465050-102465072 CTATTTCAACATTGTTCACCAGG + Intergenic
1048938759 8:139378461-139378483 CAATTTCAACAGATTTTCAAAGG - Intergenic
1050308270 9:4327907-4327929 CAATTTCAGCAGAATTAACTTGG - Intronic
1050483692 9:6112328-6112350 CTATTTCCACAGTGTTTACTAGG + Intergenic
1052363602 9:27587001-27587023 CAAATTTAACAGAGTTTAATTGG - Intergenic
1054994614 9:71371642-71371664 TCATTTCAACAGTGTTCACCTGG - Intronic
1056725608 9:89112537-89112559 CATTTTCAAGAGGGCTTACCTGG + Exonic
1058127746 9:101215067-101215089 AAATTTCAGGAGAGTTTATCTGG - Intronic
1059826468 9:118035271-118035293 CAATTTCGACACTGTCTACCTGG + Intergenic
1061377651 9:130235681-130235703 CATTTTCACTAGAGTTTGCCTGG + Exonic
1185864039 X:3606673-3606695 TAATTTTAAAATAGTTTACCTGG - Exonic
1186158434 X:6750585-6750607 CATTTTCAACAAAGCCTACCAGG - Intergenic
1188328320 X:28835358-28835380 GAATTTCAATAGAGATTTCCAGG + Intronic
1193224209 X:78962547-78962569 CCATTTCAACATGGTTTGCCTGG + Intergenic
1194942609 X:100029868-100029890 CACTTTAGACACAGTTTACCTGG + Intergenic
1194966737 X:100296898-100296920 CAATTTCATCAGCTTTTCCCAGG + Intronic
1195228951 X:102826768-102826790 CAATTGCCATAGAGTCTACCTGG + Intergenic
1195458891 X:105101229-105101251 AAATTTCGATAGAGTTTACTTGG + Intronic
1195670658 X:107466954-107466976 CAATTTCAACAGATATCAGCTGG - Intergenic
1196596864 X:117555776-117555798 CATTTCCAACTGAGGTTACCAGG + Intergenic
1197482969 X:127010084-127010106 CAATTTCAACATATATTACAGGG + Intergenic
1200800142 Y:7379341-7379363 TAATTTAAAAAGAGTTTACCTGG + Intergenic
1200839601 Y:7767577-7767599 CAATTTCAACAAAGTTTACCAGG + Intergenic