ID: 950893731

View in Genome Browser
Species Human (GRCh38)
Location 3:16428694-16428716
Sequence CGTTGTACACACATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950893731_950893733 0 Left 950893731 3:16428694-16428716 CCTAGCTCCATGTGTGTACAACG 0: 1
1: 0
2: 0
3: 7
4: 58
Right 950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG 0: 2
1: 0
2: 5
3: 34
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950893731 Original CRISPR CGTTGTACACACATGGAGCT AGG (reversed) Intronic
902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG + Intronic
904257842 1:29267704-29267726 CGTTGTACACAGAGAGAGCTGGG + Intronic
1070896383 10:79986104-79986126 CGATGTACATACAAGGAGGTGGG + Intergenic
1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG + Intergenic
1080037072 11:27721199-27721221 CGTGGAACAAACTTGGAGCTGGG - Intronic
1083781458 11:64920372-64920394 TGTGGTACACACATGGCACTGGG - Intronic
1085081010 11:73634220-73634242 GGTTGTACACACAGGAAGTTGGG - Intergenic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1099954046 12:89335336-89335358 AGGTGTACACACATGGACGTGGG + Intergenic
1104869305 12:131983215-131983237 TTTTGCACTCACATGGAGCTAGG - Intronic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG + Intergenic
1117345370 14:54826919-54826941 GTTAGTACACACATGGTGCTTGG - Intergenic
1121013867 14:90536604-90536626 GGTTGCTCACACATGGAGCTGGG - Exonic
1121501476 14:94441783-94441805 AGTGGTACACACATGCAGCTGGG + Intergenic
1123722573 15:23072541-23072563 CATTGTACACACAAGGAGACAGG + Intergenic
1124038448 15:26078494-26078516 TGTTGTACACCCATGGTGCGAGG + Intergenic
1129977136 15:79831791-79831813 CCATGTGCTCACATGGAGCTGGG - Intergenic
1130112860 15:80980452-80980474 CTATGTTCACACATAGAGCTTGG - Intronic
1135283356 16:21172031-21172053 ATTTATACACACTTGGAGCTGGG - Intronic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137822400 16:51458622-51458644 GGTTGTTCACACAAGGAGCCGGG + Intergenic
1143276177 17:5712645-5712667 GGTTGTACACTCATAGTGCTGGG + Intergenic
1149871970 17:60191063-60191085 CATTTTACAGACAAGGAGCTAGG - Intronic
1153626353 18:7025295-7025317 CGTTCTAGGCAGATGGAGCTGGG - Intronic
1163750039 19:19071300-19071322 AGATGTACACACTTGGAGCTGGG - Intronic
931835038 2:66090165-66090187 CGTAGTCGACACATGGTGCTGGG + Intergenic
938140237 2:128789466-128789488 CTTTGGACTCACGTGGAGCTGGG - Intergenic
943637392 2:190320946-190320968 GGTTTCACACACATGAAGCTAGG - Intronic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
948162019 2:235832899-235832921 TGTTGTACACTCATGAAGCAGGG - Intronic
948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG + Intergenic
1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG + Intronic
1169596707 20:7208327-7208349 AGTTGTAAACACATGAAGTTTGG - Intergenic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
954395318 3:50290336-50290358 CCTTGATCACACTTGGAGCTGGG + Intronic
955374112 3:58379840-58379862 AGTGGTACACACCTGTAGCTGGG - Intronic
955923232 3:63980413-63980435 CATAGTACACACATAGAGTTAGG - Intronic
957730482 3:84126583-84126605 CCATGTACACACATAGAGTTTGG - Intergenic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
964886250 3:161486497-161486519 GGTTGTGGAGACATGGAGCTAGG + Intergenic
972422015 4:38896545-38896567 AGTTGCCCACACATGGAGCCAGG + Intronic
973100568 4:46263462-46263484 CTTTTTTCACACATGGTGCTGGG - Intronic
984545964 4:181102934-181102956 CGCTTTATACACATGAAGCTAGG + Intergenic
986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG + Intergenic
997263055 5:132478321-132478343 CGTGGTACACACGTGGTGCTTGG + Intergenic
1002885524 6:1290355-1290377 CGTTGGAGGCACATGCAGCTGGG - Intergenic
1007522230 6:42459779-42459801 GGTTGCACACCCATGGAGCTCGG - Intergenic
1015545460 6:134356895-134356917 CTTTTCACAGACATGGAGCTGGG + Intergenic
1015945168 6:138492287-138492309 CATTGTACACACAGGGAGAGAGG - Intronic
1019329434 7:455373-455395 CGTTGTATCCACGTGGAGATGGG - Intergenic
1023653849 7:42399951-42399973 CGTTGTGGAAACATGGAGTTAGG - Intergenic
1025262768 7:57430799-57430821 AGTTGGTGACACATGGAGCTAGG - Intergenic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1033814800 7:145058675-145058697 GTTTGTACACACAGAGAGCTTGG + Intergenic
1034761024 7:153671892-153671914 CGTTTTATAGACATGGAGTTGGG - Intergenic
1053872664 9:42508729-42508751 CGATCCACACACATGCAGCTTGG - Intergenic
1054269664 9:62958023-62958045 CGATCCACACACATGCAGCTTGG + Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1059240960 9:112804912-112804934 CATTGTACACACATGCTTCTTGG - Exonic
1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG + Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1198853123 X:140986939-140986961 GGTTTTAGACACATGGAGGTGGG - Intergenic