ID: 950893733

View in Genome Browser
Species Human (GRCh38)
Location 3:16428717-16428739
Sequence ACAATTCAACAGCTGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 2, 1: 0, 2: 5, 3: 34, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950893730_950893733 1 Left 950893730 3:16428693-16428715 CCCTAGCTCCATGTGTGTACAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG 0: 2
1: 0
2: 5
3: 34
4: 362
950893731_950893733 0 Left 950893731 3:16428694-16428716 CCTAGCTCCATGTGTGTACAACG 0: 1
1: 0
2: 0
3: 7
4: 58
Right 950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG 0: 2
1: 0
2: 5
3: 34
4: 362
950893729_950893733 2 Left 950893729 3:16428692-16428714 CCCCTAGCTCCATGTGTGTACAA 0: 1
1: 0
2: 0
3: 6
4: 154
Right 950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG 0: 2
1: 0
2: 5
3: 34
4: 362
950893732_950893733 -7 Left 950893732 3:16428701-16428723 CCATGTGTGTACAACGACAATTC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG 0: 2
1: 0
2: 5
3: 34
4: 362
950893728_950893733 11 Left 950893728 3:16428683-16428705 CCAATGACGCCCCTAGCTCCATG 0: 1
1: 0
2: 0
3: 5
4: 56
Right 950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG 0: 2
1: 0
2: 5
3: 34
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950893733 Original CRISPR ACAATTCAACAGCTGAAAAA TGG Intronic
902898325 1:19495158-19495180 ACAATTCTCCAGCTGGGAAAGGG - Intergenic
902982340 1:20133969-20133991 ACAATTCAACAGGGAAAAAATGG - Intergenic
904147660 1:28406940-28406962 AAAATACAACACCTGAGAAAGGG - Intronic
906638491 1:47426627-47426649 ATAATGAAACATCTGAAAAAGGG - Intergenic
907573641 1:55506559-55506581 ATAATTCAACTGATGAACAAAGG - Intergenic
908710862 1:67012498-67012520 AAAATTCAACAGCCAAAAGATGG + Intronic
909733448 1:78925828-78925850 ACCATTCCACTGATGAAAAACGG + Intronic
909750403 1:79152782-79152804 ACAACTTAACAGGTGAAAGATGG - Intergenic
910228685 1:84963988-84964010 AAAATTAACCAACTGAAAAAAGG + Intronic
910532995 1:88262171-88262193 ACTATTCAAAAGCTGAATATGGG + Intergenic
910539607 1:88341097-88341119 ACAATTCAACCCATAAAAAATGG + Intergenic
911220163 1:95236949-95236971 TCAATTTAACAGCAGATAAAGGG - Intronic
911291620 1:96063507-96063529 ACAATTCAACAGTTGAGTACTGG - Intergenic
912935109 1:113996529-113996551 TCAAGTCAAAAGCTGTAAAAAGG + Intergenic
913268417 1:117067904-117067926 ACACTGCAAGAGATGAAAAATGG - Intronic
916573492 1:166047429-166047451 ACAATTCAAATACGGAAAAAAGG + Intergenic
917666326 1:177229312-177229334 ACAATTCTCCACCAGAAAAATGG + Intronic
917677341 1:177332457-177332479 AAAAATCCACAGCTGAATAATGG - Intergenic
917857221 1:179110488-179110510 ACAATTTCATAGCAGAAAAAGGG + Intronic
918567097 1:185947293-185947315 ACAATTGAACACTTGAAATATGG + Intronic
919004108 1:191872198-191872220 ACAATTCAAAGGGTGAAAAGGGG + Intergenic
919460756 1:197873926-197873948 ACATTTCATTACCTGAAAAATGG + Intergenic
919674339 1:200366499-200366521 AGAATTCAAAAGATGCAAAAGGG + Intergenic
920734938 1:208525026-208525048 ACAAATCATCCGCTGACAAAAGG + Intergenic
921154431 1:212427925-212427947 ACAAGTCATCAGTTGAAATAGGG - Intergenic
921430653 1:215061720-215061742 ATAATTCAACAGATTTAAAAGGG + Intronic
921877490 1:220214772-220214794 AAAATTCAACAGCTATAAAAAGG + Intronic
922518908 1:226229239-226229261 ACAATTATACAGCTTATAAATGG + Intergenic
922593113 1:226793608-226793630 ACATTTCACCAGTTTAAAAATGG + Intergenic
922881218 1:228982612-228982634 ACAATACAAAAGATAAAAAATGG - Intergenic
924714779 1:246563140-246563162 ACTGTTCAACAGCTGACACAGGG + Intronic
1063220626 10:3964042-3964064 ACAATTTAACCTCTCAAAAACGG - Intergenic
1063328166 10:5126346-5126368 ACATTTCTACAGATGAAAAGAGG + Intronic
1064329387 10:14379485-14379507 ACAATTAAGAAGCTGCAAAATGG + Intronic
1064672246 10:17727739-17727761 GCAATACAACAGCTAAAGAACGG - Intergenic
1065256700 10:23876705-23876727 CCAATTCAACTGCTGCAAGATGG - Intronic
1067190317 10:44062995-44063017 AATATTCAACAGCAGTAAAATGG + Intergenic
1068160847 10:53261950-53261972 ACAGTTCATCAGCGGAAGAAGGG - Intergenic
1070499916 10:77063008-77063030 ACTATTCTACAACTGAAGAAAGG + Intronic
1071188705 10:83076116-83076138 GCAAATCAACATCTGTAAAAGGG - Intergenic
1071368091 10:84922021-84922043 ACACTTCATCTGCTGCAAAAGGG + Intergenic
1072228239 10:93389805-93389827 ATAATTAAATAGCTGAAAATGGG + Intronic
1072281992 10:93874185-93874207 TCAATTAAACAGCTACAAAATGG + Intergenic
1072285189 10:93907747-93907769 AAAATTCAAAAGGTGTAAAAGGG - Intronic
1072386378 10:94934150-94934172 ACAATTCAATGGGGGAAAAATGG + Intergenic
1073358720 10:102879078-102879100 ACAAACCAACACCAGAAAAATGG - Intronic
1075144114 10:119868863-119868885 AAAATTAAAGAACTGAAAAAAGG + Intronic
1075939591 10:126378784-126378806 ACAATTTTAAAGTTGAAAAATGG - Intronic
1076034944 10:127191744-127191766 TCAACTGAACAGCTGTAAAAAGG + Intronic
1076325644 10:129619189-129619211 ACATTACAACAGATGCAAAAAGG - Intronic
1076556297 10:131323627-131323649 ACAATTGAAGAGGTGATAAATGG + Intergenic
1077838815 11:5949999-5950021 ACATTTCAACATAAGAAAAATGG + Intergenic
1078667922 11:13341377-13341399 AACATTCAACAGCAGAGAAAAGG - Intronic
1079422347 11:20305461-20305483 ACAATTGAATAGCTGGAAACAGG - Intergenic
1080365782 11:31572668-31572690 ACAATTCAGCAACATAAAAAGGG - Intronic
1080671309 11:34381416-34381438 AATATTCAACAGCAGAAAATTGG + Intergenic
1083523961 11:63343809-63343831 AAAATTCAACATTTAAAAAATGG - Intronic
1083910155 11:65703056-65703078 AAAATTCCAGAGCTGGAAAATGG + Intergenic
1083943118 11:65908959-65908981 AAAATTCAAAAGCTACAAAAGGG + Intergenic
1084131060 11:67134895-67134917 AAAATTCAACAACAGAAAAAGGG - Intronic
1084668539 11:70591610-70591632 ACATTTCAACAACTTAAAAAGGG + Intronic
1084920161 11:72462821-72462843 AAAAATTATCAGCTGAAAAAAGG - Intergenic
1085372765 11:76025550-76025572 ATAATTCTACAACAGAAAAATGG - Intronic
1086899430 11:92349776-92349798 AAAAATGAAAAGCTGAAAAAGGG - Intergenic
1087188085 11:95223439-95223461 ACTGTGCAACAGCTGAAGAAAGG - Intronic
1087884796 11:103466975-103466997 AATATTCACCAGCAGAAAAATGG + Intronic
1088523747 11:110728780-110728802 ACAATTAAAAAGCTGAACAGAGG - Intergenic
1090448596 11:126786084-126786106 AACATTCAACAGTTGAGAAATGG + Intronic
1090826772 11:130392800-130392822 AAAATTCAAAAGGTGCAAAAAGG + Intergenic
1091364069 11:135002480-135002502 ACAGTTCAGCAGCTCATAAAAGG - Intergenic
1091601447 12:1920331-1920353 ACAATAAAAAAGTTGAAAAAAGG - Intergenic
1092623501 12:10300307-10300329 TCAATTCAAGGGCTGAAGAATGG + Intergenic
1092829627 12:12431245-12431267 CCAATTTGACAGGTGAAAAATGG + Intronic
1093528890 12:20136802-20136824 ACAATTCAAGCGATGAAGAATGG - Intergenic
1094296854 12:28916230-28916252 ACAATCCAATAGCTGTAAGATGG + Intergenic
1095199590 12:39367153-39367175 ACACTGCATCATCTGAAAAAGGG + Exonic
1097551183 12:61072277-61072299 TCAATTCAAAATCTGCAAAAGGG + Intergenic
1097640594 12:62176746-62176768 ACAATTCTAAAATTGAAAAAGGG + Intronic
1097674028 12:62578050-62578072 ATAATTCAGCAGCTGAACTAAGG + Intronic
1097906993 12:64930916-64930938 ACATTTCTACAGATGAAAAGAGG - Intergenic
1098087704 12:66865081-66865103 ATAATTCAACATCTGGATAAGGG + Intergenic
1098178249 12:67816678-67816700 ACACTTTAACAACAGAAAAACGG + Intergenic
1098388732 12:69946735-69946757 CCATTTCATCAGCTGCAAAATGG - Intronic
1098532524 12:71557117-71557139 GCAATTCAAAAGATGAAAAAGGG + Intronic
1098567442 12:71952017-71952039 AGAATTCAAAAGCTAAACAAAGG + Intronic
1100182943 12:92105285-92105307 ACAAGTAAAAAGCTGAACAATGG - Intronic
1100520693 12:95372431-95372453 ACAACTTAAGAGCTGAAAACTGG - Intergenic
1100980719 12:100160170-100160192 ACAATTTAACAGCAGACATAAGG - Intergenic
1102203787 12:111076328-111076350 ATTATTCAACTGCTCAAAAATGG - Intronic
1102882207 12:116494251-116494273 ACAGTTCAACTTCTTAAAAATGG - Intergenic
1106056295 13:26240804-26240826 ATAAAAGAACAGCTGAAAAAAGG - Intergenic
1106150611 13:27097657-27097679 ATAATTCCTCATCTGAAAAATGG + Intronic
1106677322 13:31974745-31974767 ACAAATCAACAGTTTACAAATGG + Intergenic
1106877673 13:34091848-34091870 TCAATTTAATAGTTGAAAAATGG + Intergenic
1109781495 13:67116033-67116055 CCATTTCATAAGCTGAAAAAAGG + Intronic
1110437772 13:75494611-75494633 ATAAGCCAACAGCTGAAGAAGGG + Intergenic
1110871205 13:80454392-80454414 ACATTACATCATCTGAAAAAAGG - Intergenic
1112716741 13:102195277-102195299 ACAAATCAACAACTATAAAATGG + Intronic
1112810342 13:103211220-103211242 ACAACTCAACAGCTGATAACAGG + Intergenic
1114328498 14:21613405-21613427 ACACTTCAGCAGAGGAAAAAGGG + Intergenic
1116274931 14:42820846-42820868 AAAATGCCACAGATGAAAAAAGG + Intergenic
1116809294 14:49523917-49523939 ACAAATCAACACCTGACATAGGG + Intergenic
1117943087 14:60989938-60989960 AGAATTCAACAGAAGAGAAAAGG - Intronic
1117953002 14:61101346-61101368 ACAGGTCAGCAGCTGAATAAAGG - Intergenic
1118108157 14:62684667-62684689 ACAATAGACAAGCTGAAAAATGG - Intergenic
1119204604 14:72784656-72784678 CCAATTCAAAAGTTGAAAATGGG + Intronic
1120451671 14:84675953-84675975 AAAATTCAACAGCTGATCAGTGG - Intergenic
1120691169 14:87594724-87594746 GCTATTCAAGTGCTGAAAAAGGG - Intergenic
1122251788 14:100444938-100444960 TCATTTCAACAGCTAGAAAACGG - Intronic
1122431604 14:101652692-101652714 AAAATTCATCACCTAAAAAAAGG + Intergenic
1123834355 15:24172759-24172781 ACAAATCAACAACTGAAAAATGG - Intergenic
1123854041 15:24388312-24388334 ACAAATCAACAACTGAAAAATGG - Intergenic
1123973994 15:25535532-25535554 ACAATTCTTCAGCTGACACAGGG - Intergenic
1124526698 15:30460693-30460715 ACATTTCAACAGCTGAATTTTGG - Intergenic
1124771955 15:32546990-32547012 ACATTTCAACAGCTGAATTTTGG + Intergenic
1125751959 15:42035374-42035396 ACATTTCAACACCTGTAAACTGG + Intronic
1126096161 15:45092259-45092281 ACAATTACACAGATGAGAAAAGG - Intergenic
1126852899 15:52808766-52808788 AACATTAAATAGCTGAAAAAAGG + Intergenic
1127760500 15:62135135-62135157 TCAGTTTATCAGCTGAAAAATGG + Intergenic
1127766668 15:62192214-62192236 ATAATTCAAATACTGAAAAAAGG - Intergenic
1128651861 15:69421888-69421910 ACAATTAGCCAGCTCAAAAAAGG - Intronic
1128694737 15:69752367-69752389 CCATTTCATCATCTGAAAAATGG - Intergenic
1129781934 15:78278030-78278052 GCATTTCAACAGCAGAAAAGAGG - Intronic
1129912273 15:79238259-79238281 AAATTGCAACAGCTGGAAAATGG + Intergenic
1130523468 15:84683125-84683147 ACAATTCAGTAAGTGAAAAAAGG + Intronic
1131788633 15:95940194-95940216 ACAATAAAACAACCGAAAAAAGG + Intergenic
1133181192 16:4055861-4055883 ACAATTCCCCAGCAGAACAAAGG + Intronic
1134611512 16:15612814-15612836 AGATTTCACCAGCTGAAAGAAGG + Intronic
1138047881 16:53744873-53744895 ACCATACAACATCTAAAAAAGGG + Intronic
1138219734 16:55240479-55240501 ACAGATCAACAGATGAAATATGG + Intergenic
1138724812 16:59124393-59124415 ATAATTCAATAGCTGGAAACAGG + Intergenic
1139315014 16:66060553-66060575 CCAATTCACCAGCTTAAAACAGG - Intergenic
1141285249 16:82665930-82665952 AAAATTCAAAATCTGAAAAATGG + Intronic
1144002128 17:11064956-11064978 AGAATTCAAGAGGTGAAAGAAGG + Intergenic
1147054252 17:37822249-37822271 ACCATTCATCAACTGATAAATGG - Intergenic
1148642680 17:49200270-49200292 AAAATTCAAGAGGTGTAAAAGGG - Intergenic
1150590710 17:66559752-66559774 TCAAGTCAACAGCTTAAAAGTGG + Intronic
1150859981 17:68791186-68791208 ACATCTCAACAGCTCAAAATGGG + Intergenic
1151011709 17:70505781-70505803 ACAATACAGATGCTGAAAAAAGG + Intergenic
1153387405 18:4512478-4512500 ACAATTAAAATCCTGAAAAAGGG - Intergenic
1153437646 18:5084929-5084951 AAAATTGAATAGCTGAAAACAGG - Intergenic
1155007746 18:21743139-21743161 AAGATTCAACAGCACAAAAAGGG + Intronic
1155966546 18:32040607-32040629 ACAATCTAACAGAAGAAAAAAGG - Intronic
1158830497 18:61272297-61272319 AAAATTAAACAGCTGATAAGAGG - Intergenic
1158960588 18:62584684-62584706 ACATTTCAACGGCTGAATGAGGG - Intronic
1164142050 19:22478758-22478780 AAAATTAAACAACTGAAAAATGG - Intronic
1164871590 19:31649821-31649843 CCAATTCAATAGGTGAAAAATGG - Intergenic
1165499310 19:36175169-36175191 ACCATTGAATAGGTGAAAAATGG - Intergenic
1166535140 19:43568830-43568852 AAAATTCAAAAGGTGCAAAAGGG - Intronic
925422113 2:3720770-3720792 ACAATTCAACAAGTATAAAAAGG - Intronic
926207127 2:10841705-10841727 ACATTGCACCAGCTGACAAAGGG + Intergenic
926614827 2:14985501-14985523 ACAACTAAATAGCTGAGAAAAGG + Intergenic
928208629 2:29306241-29306263 TCAATTCTGCATCTGAAAAATGG - Intronic
928784289 2:34863608-34863630 ATAATACAACACCTGGAAAAGGG - Intergenic
928796150 2:35021977-35021999 GCAATCGACCAGCTGAAAAAGGG - Intergenic
929178365 2:39004983-39005005 ACATATCAACAGTTTAAAAATGG + Intronic
929794734 2:45050214-45050236 ACTATTCCACACCTGAAAAGAGG + Intergenic
930557778 2:52921712-52921734 ACAATTAAACAGAAGGAAAATGG - Intergenic
931390466 2:61838794-61838816 ATAATTCAAAATTTGAAAAAAGG + Intronic
931434624 2:62235849-62235871 AACATTGAACAGCTGAAGAAAGG - Intergenic
931499292 2:62846409-62846431 TCAATTCAACAGATGCAGAAAGG + Intronic
931558166 2:63528050-63528072 ACAAATAAACCCCTGAAAAAGGG - Intronic
932170112 2:69547036-69547058 ACAATTCAATGGGTGAAAAATGG + Intronic
933392138 2:81684397-81684419 ACAATTCAAAATCAGAAGAAAGG - Intergenic
934496145 2:94801466-94801488 ACAATTCAAAAAATGAAAAATGG + Intergenic
936000486 2:108823668-108823690 ACAATATAACAGATAAAAAAGGG + Intronic
936827065 2:116594548-116594570 ACAATTAAAAAACAGAAAAAGGG - Intergenic
936833153 2:116673812-116673834 ATGACTTAACAGCTGAAAAATGG + Intergenic
937210936 2:120270218-120270240 TTAATTCAACAGCTAAAAAACGG - Intronic
939036268 2:137134821-137134843 CCTATTCTACATCTGAAAAAGGG - Intronic
939710838 2:145517914-145517936 AAAGTTCATCAGCTGATAAATGG + Intergenic
939957091 2:148536192-148536214 TCATTTAAACAGCTGAGAAATGG + Intergenic
940927826 2:159386699-159386721 ACAATACAAGAGGGGAAAAAAGG - Intronic
941690441 2:168495875-168495897 AAAATTCAACAGGTACAAAAAGG + Intronic
941732310 2:168932377-168932399 ACAATACTGCAGGTGAAAAATGG - Exonic
941737526 2:168995561-168995583 TCAATACAACAGTTGAGAAAAGG + Intronic
943641261 2:190361120-190361142 ACAATGCAATGGGTGAAAAAAGG + Intronic
943960827 2:194261507-194261529 AAAATTCAACCTTTGAAAAATGG - Intergenic
945066411 2:205951066-205951088 ATAAATCAAGAGCAGAAAAAAGG + Intergenic
946908149 2:224435785-224435807 ACAATTCATCAGCTGAATCCAGG + Intergenic
1169659764 20:7965359-7965381 AAAATGGAACACCTGAAAAATGG - Intergenic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170946845 20:20899082-20899104 TCAATTCAATAGCTTCAAAAGGG - Intergenic
1172535875 20:35672833-35672855 CCAATTCCAAACCTGAAAAAAGG + Exonic
1172609834 20:36241967-36241989 CCAATTGGATAGCTGAAAAATGG + Intronic
1173908259 20:46644606-46644628 CCAGTTCCCCAGCTGAAAAATGG - Intronic
1175476069 20:59275393-59275415 TCAATTCTACATCTGTAAAATGG + Intergenic
1175548439 20:59797741-59797763 AAAATTCACAAACTGAAAAAAGG - Intronic
1177014745 21:15772422-15772444 ACAATTCAACAGCACACACATGG - Intronic
1177059983 21:16360360-16360382 ACAACTCAACAGAAAAAAAAAGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177665332 21:24149439-24149461 ACAATTCAACTGCTGAAGGCAGG - Intergenic
1178365640 21:31986905-31986927 ACAAATAAACAGCTGCAAATGGG - Intronic
1178462307 21:32814022-32814044 ACAATTCATCAGACCAAAAAAGG - Intergenic
1179556067 21:42177042-42177064 ACATTTCAACCACTTAAAAATGG - Intergenic
1180523810 22:16235205-16235227 ACAGTTCATGAGCTGAAACAGGG + Intergenic
1181610800 22:24010472-24010494 AGAATTCCAGAGATGAAAAAAGG - Intergenic
1182143322 22:27981156-27981178 AAAATTCAGCAGCTAATAAAAGG + Exonic
1182648578 22:31831110-31831132 ACATTTCAACAGCTAAAAATTGG + Intronic
1183531446 22:38356048-38356070 ACTGTTCAACAGCTGACACAGGG - Intronic
1184579247 22:45402584-45402606 ATAATTCAACAGCAGTTAAAAGG + Intronic
949584409 3:5423754-5423776 ACAATAGAGCAGCTGAGAAAAGG - Intergenic
949937256 3:9125634-9125656 ACAATTCAAAAGCTGGAAGCTGG + Intronic
950436167 3:12981562-12981584 ACAATTCAAAAGATACAAAAGGG - Intronic
950893733 3:16428717-16428739 ACAATTCAACAGCTGAAAAATGG + Intronic
953533890 3:43762365-43762387 TCAATTTCACACCTGAAAAATGG - Intergenic
955255172 3:57324357-57324379 ACAATTCAATAGGTTAAAAATGG - Intronic
955646816 3:61148414-61148436 AAAATTCAATAGCTGACAAAAGG - Intronic
955857346 3:63287341-63287363 AGAATTCATCAACTAAAAAAAGG - Intronic
956201671 3:66712723-66712745 GCAATGCAAAAACTGAAAAATGG + Intergenic
956312016 3:67891747-67891769 ACAAAGAAACAGCTGAGAAAGGG - Intergenic
956391854 3:68782142-68782164 ACAACTCAACAAAAGAAAAAAGG + Intronic
956639377 3:71401218-71401240 ACAGTTCAAAAGTTCAAAAAGGG + Intronic
956912138 3:73829035-73829057 AAAATCCCACAGCTGAAAATAGG - Intergenic
956982268 3:74652888-74652910 ACAATTCAGCATCAGATAAAGGG + Intergenic
957436555 3:80184742-80184764 ATAATTAAACAGGTGAAAATTGG + Intergenic
959129011 3:102328783-102328805 AAAATTCAACATACGAAAAAGGG + Intronic
959781291 3:110236786-110236808 ACAATTCAACAGATGAAATGCGG - Intergenic
960082967 3:113560584-113560606 ACAGTTAAACATTTGAAAAAAGG + Intronic
961095077 3:124147464-124147486 ACAATTCAAAACCTAATAAAAGG - Intronic
961805560 3:129487030-129487052 TCAATTCTAAAGCTAAAAAATGG + Intronic
961914428 3:130357572-130357594 AAAATTCAACAGCACATAAAAGG + Intronic
962019508 3:131483026-131483048 AGAATTCAACAGAAAAAAAATGG + Intronic
962746030 3:138397958-138397980 ATAATTTGACAGGTGAAAAATGG - Intronic
964940172 3:162150173-162150195 ACAATAAAACAACAGAAAAATGG - Intergenic
965541134 3:169872174-169872196 ACAATACAGCAGCTAAAAACTGG + Intergenic
966390676 3:179449948-179449970 ACAATTCTACAGGTTAACAAAGG + Intronic
967151118 3:186652025-186652047 ACAATTTCAGAGCTGAATAATGG - Intronic
967739917 3:192993789-192993811 AAAATTAAACAGCTAGAAAATGG - Intergenic
968617398 4:1584197-1584219 ACAAATCATAAGATGAAAAATGG - Intergenic
969326384 4:6446793-6446815 ACCATTCAGCAGATGACAAAAGG + Intronic
970003210 4:11385263-11385285 ACAACTCAGAAGCTGACAAATGG + Intergenic
970034211 4:11713766-11713788 ACAAATCAATACCTGATAAAAGG + Intergenic
970910187 4:21266052-21266074 CCCATTTAACAGATGAAAAATGG + Intronic
971590609 4:28463775-28463797 ATAATTCCACAGTTTAAAAAAGG - Intergenic
971721183 4:30246996-30247018 ACAATCCTACAGATGAAAAGAGG - Intergenic
972487767 4:39558620-39558642 ACAATCCCACAGCTGGAAAAAGG + Intronic
972632168 4:40851827-40851849 ACAATTCTGCAGCTGGAAGAAGG + Intronic
973340774 4:49001623-49001645 ACAATTCAAATGCTACAAAAGGG - Intronic
974097783 4:57383984-57384006 ACCATGCACCAGCTGAAACAGGG + Intergenic
975626831 4:76358638-76358660 GGAATTCAGCAGGTGAAAAAGGG - Intronic
975696321 4:77017069-77017091 ACAGTTCTACAGCAGAATAAAGG - Intronic
976166262 4:82258271-82258293 ACAGTTCATCACCTCAAAAAAGG + Intergenic
976213777 4:82696410-82696432 ACAATTCAATATCTAATAAAGGG + Intronic
976763740 4:88577790-88577812 ACAATTCAAAAGGTAAGAAAGGG + Intronic
976833408 4:89341657-89341679 ACAACTCAAAAGCTGAGAAGAGG + Intergenic
976846501 4:89494415-89494437 ACAATACAAAAGATAAAAAATGG - Intergenic
978056385 4:104273415-104273437 ACAATTACACATTTGAAAAAAGG + Intergenic
978346837 4:107779466-107779488 AGAATTCAACATGAGAAAAATGG - Intergenic
978807817 4:112818887-112818909 ACAATTCACTAGCTGGGAAAGGG - Intronic
978960167 4:114667854-114667876 ACATTTCAACTACTTAAAAATGG + Intronic
979785096 4:124707255-124707277 ATAATTCAACAGGTGGAAAATGG - Intronic
979912410 4:126384245-126384267 ACAATTCTATAGCTGATAAATGG + Intergenic
982044265 4:151426676-151426698 ACATTACAACAGCTGAAAGATGG - Intronic
982244474 4:153336777-153336799 CCAAATCAACCTCTGAAAAAAGG + Exonic
982454246 4:155589139-155589161 AGGATTTAACAGCTTAAAAAAGG - Intergenic
983579214 4:169291244-169291266 AAAATAGAACTGCTGAAAAAGGG - Intergenic
983882707 4:172951308-172951330 TCAATTCCAAAGCTGACAAAAGG + Intronic
984233017 4:177122106-177122128 AGAAGTCAACAGCTGACAAAAGG - Intergenic
985352685 4:189083077-189083099 ACAATTGTGCAGCTGAAATAAGG - Intergenic
986260827 5:6144974-6144996 ACAATGAAAAAGCAGAAAAATGG - Intergenic
986396619 5:7336950-7336972 ACTTTTCAAGAGCTGGAAAATGG + Intergenic
987193064 5:15499489-15499511 ACACTTCTACAGCTTTAAAATGG - Intergenic
988060815 5:26166977-26166999 CCAATTCAACACATTAAAAAGGG + Intergenic
988661034 5:33268775-33268797 ACAATTCAAATGCTGGAAAGTGG + Intergenic
989067515 5:37479228-37479250 AAGATTTAACAGCTGAAAGAGGG + Intronic
989171610 5:38475458-38475480 ACATTTCAAGAAATGAAAAAGGG + Exonic
989224355 5:39009032-39009054 TCAACTCAACTGCTTAAAAAGGG + Intronic
989323845 5:40166664-40166686 ACAATCCAAGAGTTGAAATATGG + Intergenic
989368019 5:40678239-40678261 ACAAATCAACATTAGAAAAAAGG - Intergenic
989700622 5:44259955-44259977 ACAATCTAACATCTGTAAAATGG - Intergenic
990414193 5:55570651-55570673 TCAGTTCAACAGTTAAAAAATGG + Intergenic
990642455 5:57802722-57802744 AACATTCAAGAGGTGAAAAAAGG - Intergenic
990810960 5:59722897-59722919 AGCATTCAACAACAGAAAAAGGG - Intronic
990831985 5:59969587-59969609 ACAATTCAAAAGATGAGATATGG - Intronic
991118703 5:62985278-62985300 ATGATCCAAGAGCTGAAAAATGG + Intergenic
991139263 5:63220314-63220336 TCAATTCAAAATCTGAAACATGG - Intergenic
991265991 5:64718785-64718807 AGAATTCAACAGAAAAAAAAAGG + Exonic
991997511 5:72402589-72402611 ACAGTTCAACAACTGGAAATAGG - Intergenic
992675786 5:79104611-79104633 AAAATTCAAAAGTTAAAAAAGGG - Intronic
994006333 5:94841510-94841532 ACTAATCAGCTGCTGAAAAATGG - Intronic
994361452 5:98853631-98853653 TAAATACAACAGCTTAAAAAGGG - Intergenic
994655343 5:102585907-102585929 AAAATTAAACAGCTTTAAAAAGG - Intergenic
995057544 5:107776871-107776893 AGAATTTAAGAGCTGAAAACAGG - Intergenic
995067065 5:107874488-107874510 CAAATTCACCAACTGAAAAATGG - Intronic
996593552 5:125175850-125175872 CCAATTCTACATCTGGAAAACGG - Intergenic
996945976 5:129068038-129068060 ACAAAATAACAGCTGAGAAAAGG - Intergenic
997133971 5:131305234-131305256 ACAATTCATCAACTGGAGAATGG - Intronic
999930766 5:156431212-156431234 ACATTTCTACAGATGAAAAGAGG - Intronic
1000492734 5:161934958-161934980 ACAATTGAACATCTTTAAAATGG - Intergenic
1000580797 5:163033608-163033630 ACAATAAAACACCTGAAATATGG - Intergenic
1001176348 5:169472372-169472394 TTAATCCAAAAGCTGAAAAACGG + Intergenic
1002405951 5:179031588-179031610 ACAAATCAACAGCAGTACAAAGG - Intronic
1002972597 6:2039192-2039214 ACAGTACAAGAGATGAAAAATGG + Intronic
1003243843 6:4367840-4367862 AGAAGTCAACAGCAGATAAAGGG + Intergenic
1003418328 6:5933209-5933231 ATAACTCAAGAGCTGAAAACAGG + Intergenic
1005316800 6:24610836-24610858 AACATTCATCAACTGAAAAACGG + Intronic
1006113825 6:31764597-31764619 TTAACTCAACAGCTAAAAAATGG + Exonic
1007143725 6:39605279-39605301 TCAATTTAAAAGATGAAAAATGG - Intronic
1007876145 6:45103622-45103644 ACAAAACAACAGAAGAAAAAGGG + Intronic
1007977420 6:46115497-46115519 AAAACCCAAAAGCTGAAAAAAGG - Intergenic
1008795617 6:55299132-55299154 AGAATTGAACAGCAGGAAAAGGG + Intergenic
1009761755 6:68015611-68015633 ACATTTTAATAACTGAAAAAAGG + Intergenic
1011638644 6:89399363-89399385 ACCATTAAACAGCTGAGAAAGGG + Intronic
1012576219 6:100803195-100803217 ACTATTCAACAGGTGTAATATGG + Intronic
1012712146 6:102620395-102620417 ACAAATAATCAACTGAAAAATGG - Intergenic
1012898331 6:104977476-104977498 ACAATTCAGTAGGAGAAAAAAGG - Intronic
1012951185 6:105519742-105519764 TCAATTCAACAAATGAAGAAAGG + Intergenic
1013336831 6:109172075-109172097 TAAAATCAGCAGCTGAAAAAAGG + Intergenic
1013771132 6:113629407-113629429 CTAAGTCAAAAGCTGAAAAAAGG + Intergenic
1013962708 6:115919726-115919748 AAAATATAACAGATGAAAAAGGG + Intergenic
1014020380 6:116580607-116580629 ATAATACAGCAGATGAAAAAAGG + Intronic
1014257193 6:119173145-119173167 AGAATGCAAAAGCTGAAAGAAGG + Intergenic
1014374336 6:120653739-120653761 ACAATTCCTCATCTGAAAGATGG + Intergenic
1014408200 6:121078383-121078405 AAAATTTAACATCTGAAAATTGG + Intergenic
1014882611 6:126742309-126742331 ATCATTCAACAGGTGAGAAATGG - Intergenic
1015849993 6:137561798-137561820 AAAATTCAAAAGGTAAAAAATGG - Intergenic
1016373250 6:143395518-143395540 ATAATCCAAGAGCTCAAAAATGG + Intergenic
1018748998 6:166785604-166785626 TAGGTTCAACAGCTGAAAAACGG - Intronic
1019038244 6:169080838-169080860 ACAATTCAACCGTTGACATAGGG - Intergenic
1021052940 7:16011832-16011854 ACATTTTAAAAACTGAAAAAAGG + Intergenic
1021244391 7:18244139-18244161 ACAAGTGAACAGCTGAGCAAGGG + Intronic
1021867904 7:24977503-24977525 CCAATTCTTCACCTGAAAAATGG + Intronic
1021961772 7:25880317-25880339 AAAATTCAGGAGCTGGAAAAGGG - Intergenic
1023318341 7:38965458-38965480 ATAATTAAACAAATGAAAAATGG - Intergenic
1025220042 7:57099655-57099677 AAAATTCAAGATGTGAAAAATGG + Intergenic
1025630821 7:63271236-63271258 AAAATTCAAGATGTGAAAAATGG + Intergenic
1025651650 7:63475379-63475401 AAAATTCAAGATGTGAAAAATGG - Intergenic
1026135058 7:67652686-67652708 GCAATTCAACAGCTAAAAAAAGG - Intergenic
1027763066 7:82304002-82304024 ACAATTCAACAGTTAAAAAATGG + Intronic
1028059427 7:86292523-86292545 ACAACTCAACAGAAAAAAAAAGG - Intergenic
1028381521 7:90205302-90205324 ACAATTTAACTTCTGTAAAACGG - Intronic
1030692307 7:112547823-112547845 AAAATTCAAAAAGTGAAAAAAGG + Intergenic
1031489500 7:122369521-122369543 AGATTTCAACAATTGAAAAAAGG - Intronic
1032713330 7:134482139-134482161 ACACTTCATTAGGTGAAAAATGG + Intergenic
1032985002 7:137328086-137328108 GTAATTCTACAGCTGAAACAGGG - Intronic
1032987358 7:137353072-137353094 ACAACTCAACAGCAGATCAAGGG - Intergenic
1033562259 7:142544002-142544024 ACAATTTAACAGCTCAGAATGGG - Intergenic
1034140826 7:148814345-148814367 ACTATTTAACAAATGAAAAATGG - Intronic
1037386025 8:18342859-18342881 ACAACCCAACAGCTTAAAAATGG + Intergenic
1037566758 8:20124583-20124605 ACAACACGACAGCTGAAGAAGGG - Intergenic
1039355926 8:36815423-36815445 AAAATTCAAAGGCTGAAATAAGG + Intronic
1040510561 8:48089570-48089592 ACAAATGAACGACTGAAAAATGG - Intergenic
1041565231 8:59269940-59269962 ACAATTCAAGAACAGTAAAATGG - Intergenic
1041701412 8:60793105-60793127 ACAATACTACAGCTGAACACTGG - Intronic
1041868092 8:62599618-62599640 ACTATGCAAGAGCTGTAAAAGGG + Intronic
1042503905 8:69539206-69539228 ACAACTTAAAAGCTGAGAAATGG + Intronic
1043252956 8:78098851-78098873 ACAAAGCATCAACTGAAAAAAGG + Intergenic
1043746761 8:83882676-83882698 ACATTTTAACAGCTGTAAAAAGG - Intergenic
1043764279 8:84110038-84110060 ACAATTCAACTGGTGCAAACAGG - Intergenic
1043799955 8:84596294-84596316 ACAATTGAAGAGCTAAAATATGG - Intronic
1043914831 8:85909899-85909921 GCAATTCAACAGCTCCAAATTGG - Intergenic
1044152111 8:88793836-88793858 ACAATTCAATGGAGGAAAAATGG + Intergenic
1044824613 8:96184198-96184220 CCATTTCCTCAGCTGAAAAATGG - Intergenic
1044963194 8:97551191-97551213 ATGATTGAAGAGCTGAAAAATGG - Intergenic
1045545154 8:103122048-103122070 ACCATTCAACAGCTGAGGAAAGG + Intergenic
1046731348 8:117729784-117729806 ACAATTCTGGAGCTGAGAAATGG - Intergenic
1047065343 8:121275761-121275783 ACCATTAAAGTGCTGAAAAAAGG + Intergenic
1050212586 9:3279276-3279298 ACAATTCCATAGCTGAAAAGGGG - Intronic
1050628044 9:7527100-7527122 AGAATTCAACAGATTTAAAAAGG - Intergenic
1051226981 9:14909614-14909636 ACAATTACACAGTTAAAAAATGG + Intronic
1051248695 9:15137485-15137507 AATATTTAACAGCAGAAAAATGG - Intergenic
1051764332 9:20505899-20505921 ACGTAACAACAGCTGAAAAATGG - Intronic
1052542933 9:29834625-29834647 AGAATTCAACAGATAAAGAAGGG - Intergenic
1052732268 9:32302463-32302485 GCAATTCAACAGGTCAAAAAAGG + Intergenic
1052732328 9:32303636-32303658 GCAATTCAGCAGGTCAAAAAAGG + Intergenic
1053660994 9:40278915-40278937 ACAATTCAAAAAATGAAAAATGG - Intronic
1053911371 9:42908252-42908274 ACAATTCAAAAAATGAAAAATGG - Intergenic
1054373115 9:64425131-64425153 ACAATTCAAAAAATGAAAAATGG - Intergenic
1054523616 9:66097369-66097391 ACAATTCAAAAAATGAAAAATGG + Intergenic
1054680746 9:67914908-67914930 ACAATTCAAAAAATGAAAAATGG - Intergenic
1055711759 9:79070912-79070934 GCTATTCAACAGGTGAAAAGTGG - Intergenic
1056815773 9:89799762-89799784 CAAATTCAGCAGCTGAAACAAGG - Intergenic
1057249518 9:93489125-93489147 ACATTTCAACACTTAAAAAAAGG + Intronic
1057613686 9:96569129-96569151 ACAATGCAAAAGCTGTAAAAAGG - Intronic
1058273579 9:103008406-103008428 AAAATTCAACAGCATAAGAATGG - Intronic
1058865819 9:109161244-109161266 ACAATTTAAGTGATGAAAAATGG - Intronic
1059520874 9:114940744-114940766 AGAAATCAACAGCTTACAAATGG - Intergenic
1059535816 9:115079686-115079708 CAGATCCAACAGCTGAAAAATGG - Intronic
1059898210 9:118892236-118892258 AGAATTGAAAAGCTGAAAACAGG + Intergenic
1060379677 9:123155601-123155623 AAGATTCAAGAGCTGAAATAAGG + Intronic
1060940008 9:127537790-127537812 ACAATTAAACAGCTCAGGAAAGG + Intronic
1061503407 9:131016655-131016677 TCAGTGCAACAGCTGACAAAGGG + Intronic
1186253572 X:7695561-7695583 ACAAGTCAATAGCTGATGAAGGG + Intergenic
1186391676 X:9166251-9166273 ATAATTCAACAGAAGACAAATGG + Intergenic
1188077550 X:25797262-25797284 CCAATTGAAAAGATGAAAAATGG + Intergenic
1188790491 X:34403516-34403538 ACTTTTCTACAGATGAAAAATGG - Intergenic
1191033048 X:55996242-55996264 ACAATACAAGAGCTGAAAAATGG - Intergenic
1191175527 X:57496792-57496814 ACAATTTAAGAGCTGAAAGATGG + Intergenic
1193265234 X:79461027-79461049 AGAATTCTATAGCTTAAAAAAGG + Intergenic
1193351682 X:80471439-80471461 ACAATTTAACAGCAGACATAAGG + Intergenic
1193460858 X:81789769-81789791 ACATTTCTACAGATGAAAATAGG - Intergenic
1193589509 X:83370612-83370634 ACAAATCAATAGCAAAAAAAAGG - Intergenic
1193651688 X:84142671-84142693 ACAATTCCACAACTACAAAAAGG + Intronic
1193887686 X:87004016-87004038 AATATTCAACTACTGAAAAAAGG - Intergenic
1195947732 X:110232940-110232962 CCAATTCAAAAGCTAACAAAAGG + Intronic
1196207223 X:112954660-112954682 AAAAAACAACAGCTGAAAGAAGG - Intergenic
1196371780 X:114987234-114987256 ACAATACAACAGCTGTGACAAGG - Intergenic
1196412226 X:115432358-115432380 ACAATTTAAGTGATGAAAAATGG - Intergenic
1198596078 X:138237194-138237216 ACATTCCAACAGGTGTAAAATGG - Intergenic
1199077192 X:143537191-143537213 ACATTTCTACAGATGAAAAGAGG + Intergenic
1199730735 X:150629739-150629761 ACAATTCAGGAACTGTAAAAGGG + Intronic
1200839976 Y:7771405-7771427 ACAATTCAACAGCTGAAAAATGG + Intergenic