ID: 950896194

View in Genome Browser
Species Human (GRCh38)
Location 3:16453675-16453697
Sequence TGTAACGTATTTACTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950896194 Original CRISPR TGTAACGTATTTACTGCTAT GGG Intronic
903882936 1:26524269-26524291 TGTCAAGTATTGATTGCTATGGG + Intergenic
908835460 1:68225039-68225061 AGTAAAGTATTTACTTCTTTGGG + Intronic
910809144 1:91218419-91218441 AGTAACATCTTTAATGCTATGGG + Intergenic
913086932 1:115447530-115447552 TTTCAGGTTTTTACTGCTATTGG - Intergenic
913184856 1:116361587-116361609 TGTAAGGTATTTGTTTCTATAGG + Intergenic
918862698 1:189852428-189852450 TGTTTCCTATTTACTGATATGGG + Intergenic
918951213 1:191141776-191141798 TGTAACATATTTACTGAAGTAGG + Intergenic
921081125 1:211739048-211739070 TGAAAGGTATTTACTGTTAGGGG - Intergenic
1063110923 10:3036848-3036870 TGTAAGGTACTTCCTGCTAAAGG + Intergenic
1063736561 10:8762067-8762089 TGTAACATATTTATGGCTTTTGG + Intergenic
1071723356 10:88169738-88169760 TGTAACTTATTTCCTGCTTGGGG - Intergenic
1076486188 10:130819447-130819469 TGTAACATTTTTCCAGCTATAGG - Intergenic
1090812957 11:130263320-130263342 TGTAACATATTTGCTGATTTAGG + Intronic
1101047457 12:100823958-100823980 TGTAGCATTTTTACTCCTATTGG - Intronic
1103294704 12:119876549-119876571 TGTAAGGTGTTAAGTGCTATGGG + Intronic
1109837198 13:67875924-67875946 TGTAACATATTTACTGTTTCTGG - Intergenic
1110984209 13:81942620-81942642 TGAAATATTTTTACTGCTATTGG - Intergenic
1116253250 14:42515565-42515587 TGGAATGTATTTAATGCTGTTGG + Intergenic
1116509884 14:45731635-45731657 TGTCAAGTCATTACTGCTATGGG + Intergenic
1116823090 14:49644622-49644644 TATAATGTATTTACTACTAATGG - Intronic
1117460955 14:55944241-55944263 TGTAACATATTTATTAATATAGG - Intergenic
1125307179 15:38332035-38332057 TGTAACTTGTATACTGGTATGGG + Intronic
1125369048 15:38950691-38950713 TAAAAATTATTTACTGCTATAGG + Intergenic
1127352306 15:58165538-58165560 TGTAATGTATTTACTACAATTGG + Intronic
1132063108 15:98708859-98708881 TGGAAAGTATTTACTGTTCTGGG + Intronic
1134221161 16:12355355-12355377 TGTAAAGTACTTACTGCAAATGG + Intronic
1138821238 16:60262428-60262450 TTGAACTTATTTACTGCCATAGG + Intergenic
1153456970 18:5293743-5293765 TGTAAGGTATATACTTCTATAGG - Intronic
1155510213 18:26568734-26568756 TGTAACTAATTTGCTGCTACTGG + Intronic
1157965057 18:52199317-52199339 TGTCTCGTAGTCACTGCTATTGG + Intergenic
1159190492 18:65035567-65035589 AGTAACGTATTTTCTGAAATAGG + Intergenic
931024340 2:58092271-58092293 TGTAAGGTATGTACTGTTTTGGG + Intronic
933889018 2:86748444-86748466 CGTAACTTATTTGCTGCTCTTGG - Intronic
940846245 2:158645114-158645136 TGTAACGTATATTCTACTTTTGG - Intronic
946700831 2:222411585-222411607 TGTAAGGTTTTTCCTGCTTTTGG - Intergenic
946824739 2:223665763-223665785 TGTAAAGTACTTGCTGCTATGGG + Intergenic
1171101703 20:22389823-22389845 TGTATGATATTTACTGCTATAGG + Intergenic
1172806592 20:37616259-37616281 TGTAAGGCAGTTACTGCTGTAGG + Intergenic
950354823 3:12398180-12398202 TCTATCATTTTTACTGCTATCGG - Intronic
950896194 3:16453675-16453697 TGTAACGTATTTACTGCTATGGG + Intronic
952083125 3:29784658-29784680 TGTTACGTATTTTCTTCTGTTGG - Intronic
952351935 3:32547766-32547788 TTTAACGTATTTACTTCCTTTGG - Intronic
955694828 3:61625245-61625267 TGTTACGTATGTACTGTGATGGG - Intronic
958455025 3:94320047-94320069 TGAAACTTAATGACTGCTATTGG + Intergenic
959598846 3:108156449-108156471 TGTTACGTATTTACTGCGTCTGG + Intergenic
959893948 3:111586320-111586342 TGTAAGTTATTTAATGTTATTGG - Intronic
964810886 3:160663578-160663600 TGTTACCTATTTGCTGCTCTTGG - Intergenic
965561980 3:170070809-170070831 TGTAGCCAATTTCCTGCTATTGG + Intronic
971662233 4:29433862-29433884 AGGAAAGTTTTTACTGCTATTGG + Intergenic
971804147 4:31333630-31333652 TGTTATGTATCTATTGCTATTGG + Intergenic
974080546 4:57207944-57207966 TGTAACTTATTTTCTTCTCTGGG - Intergenic
975419446 4:74145612-74145634 TGTAACTTTGTTATTGCTATAGG - Intronic
975598048 4:76068818-76068840 TGTAAAGTATTCACTTGTATGGG + Intronic
978458238 4:108919691-108919713 ATTAATATATTTACTGCTATAGG + Intronic
978937089 4:114390803-114390825 AGTAACGTATTTTCTAATATAGG + Intergenic
980252031 4:130329536-130329558 TGTAACGTATTTACAGGTTCCGG - Intergenic
980522004 4:133947630-133947652 AGTAACGTATCAACTGTTATTGG - Intergenic
981035263 4:140162400-140162422 TTTAAGGTAATTACAGCTATAGG + Intergenic
982547368 4:156751111-156751133 TGTGATGAATTTACTTCTATGGG + Intergenic
983336345 4:166398293-166398315 TGTAACCTATTTACAGGTATTGG - Intergenic
991462808 5:66877253-66877275 TGTAAGGTAAGTACTGCTATGGG + Intronic
992365342 5:76084288-76084310 GGTAGCTTATTTACTGCGATTGG - Intronic
993082035 5:83313426-83313448 TGTAACCAGTTTACTGCTGTAGG + Intronic
996431363 5:123381924-123381946 TGTAAAGTATTTTGTGCTTTTGG - Intronic
996974175 5:129410244-129410266 TTTATGGTATTTAATGCTATAGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1010784812 6:79988514-79988536 TGTAACTTATACACTGCTAGTGG + Intergenic
1013266244 6:108501988-108502010 TGTAGTGTTTTTACTGTTATAGG + Intronic
1014104031 6:117542978-117543000 TGTTAGGCATTTACTGATATTGG - Intronic
1017861314 6:158400328-158400350 TGTAATGTATATACTTTTATTGG - Intronic
1024453046 7:49570903-49570925 TTTGACGGATATACTGCTATTGG - Intergenic
1031544822 7:123037909-123037931 GGTAACATATTTACCGCTCTTGG + Intergenic
1033861030 7:145628053-145628075 TATATCTTATTTTCTGCTATAGG - Intergenic
1037332601 8:17758625-17758647 TGTAGCATATTTAGTGCTTTTGG - Intronic
1041431129 8:57781855-57781877 TGAAACTTATTTAGCGCTATGGG - Intergenic
1043790511 8:84461711-84461733 TTTAATGTATTTACTGTAATTGG + Intronic
1045136253 8:99222007-99222029 TGTTACTTATCTACTGCTCTTGG + Intronic
1045704869 8:104910816-104910838 TGTAAGGTATTTACTGAGAGAGG + Intronic
1047186528 8:122638186-122638208 TGAAACGTATTTATTGTTCTGGG - Intergenic
1051328161 9:15995855-15995877 TGTCATATATTCACTGCTATGGG + Intronic
1055251366 9:74310615-74310637 TCCAATGTTTTTACTGCTATTGG - Intergenic
1056079517 9:83077010-83077032 ACTAATGTATTTTCTGCTATTGG + Intergenic
1056251630 9:84754211-84754233 TGTATAGTAGTTACTGCTGTAGG - Intronic
1059499616 9:114739881-114739903 TGTATCTTATTTAATCCTATGGG + Intergenic
1188378998 X:29468287-29468309 GGAAGCGTATTTACTGCTAATGG + Intronic
1192173666 X:68872837-68872859 TATAAAGTATTCAATGCTATGGG + Intergenic
1198433311 X:136589548-136589570 TGTAACGTATTGCCTGATAAGGG - Intergenic
1201680075 Y:16636189-16636211 TGTAAAATATTTAGTGCTGTGGG - Intergenic
1201956037 Y:19623749-19623771 TGTAACATATTTAGTGCTGAAGG + Intergenic