ID: 950896313

View in Genome Browser
Species Human (GRCh38)
Location 3:16454785-16454807
Sequence GTTTTCTGGCGTGTCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950896306_950896313 18 Left 950896306 3:16454744-16454766 CCCTCCTTGTGTCAAGGCACCAT 0: 1
1: 1
2: 1
3: 12
4: 143
Right 950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 105
950896308_950896313 14 Left 950896308 3:16454748-16454770 CCTTGTGTCAAGGCACCATCTAG 0: 1
1: 1
2: 0
3: 10
4: 106
Right 950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 105
950896303_950896313 27 Left 950896303 3:16454735-16454757 CCAAGGCCTCCCTCCTTGTGTCA 0: 2
1: 0
2: 0
3: 35
4: 323
Right 950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 105
950896309_950896313 -1 Left 950896309 3:16454763-16454785 CCATCTAGCACTCACCATCACAG 0: 1
1: 1
2: 0
3: 19
4: 167
Right 950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 105
950896305_950896313 21 Left 950896305 3:16454741-16454763 CCTCCCTCCTTGTGTCAAGGCAC 0: 2
1: 0
2: 0
3: 11
4: 150
Right 950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 105
950896307_950896313 17 Left 950896307 3:16454745-16454767 CCTCCTTGTGTCAAGGCACCATC 0: 1
1: 1
2: 1
3: 12
4: 152
Right 950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG 0: 1
1: 0
2: 1
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950896313 Original CRISPR GTTTTCTGGCGTGTCTCCCA GGG Intronic
901115199 1:6838230-6838252 CTTTTCTGGGGTAGCTCCCATGG - Intronic
901591582 1:10348565-10348587 GTTTTCTGGCCTGTATGGCATGG - Intronic
906195140 1:43925596-43925618 GTTACCTGGGGTGTCTCACATGG + Intronic
909033854 1:70574344-70574366 GTTTGATGCTGTGTCTCCCATGG + Intergenic
915740485 1:158115129-158115151 GATACCTGGCCTGTCTCCCAGGG + Intergenic
919019084 1:192080336-192080358 ATTTTCTGTCTTGTCTCCTAAGG - Intergenic
919976902 1:202618776-202618798 AGCTACTGGCGTGTCTCCCAGGG - Intronic
922127221 1:222739650-222739672 GTTCTCTTGCGTGTCTTACAGGG - Intronic
923187553 1:231588700-231588722 GTCTTCTGGCATCTCTCCTATGG - Intronic
923888391 1:238183316-238183338 GTTGTCTGGGGTGACACCCAAGG + Intergenic
1063052741 10:2470708-2470730 GTTTTCAGGTGTGGCTGCCATGG + Intergenic
1064002516 10:11675285-11675307 GATTTCTGGTGTGTCTGCAAGGG - Intergenic
1069568569 10:69480076-69480098 GTGTTCTGGAGTGGGTCCCAGGG + Intronic
1071021283 10:81060096-81060118 GAGTTCTGGCGGCTCTCCCAAGG + Intergenic
1075288787 10:121210279-121210301 GTTTTCTGCAGTGACTCCCCTGG + Intergenic
1075964583 10:126600308-126600330 ATTTTCTGTAGCGTCTCCCAGGG - Intronic
1081719828 11:45280316-45280338 GCTTTCTGCTGTTTCTCCCATGG - Intronic
1086356344 11:86004815-86004837 GTTTTCTACTGTGTCTCCCTTGG - Intronic
1087111083 11:94468226-94468248 ATCTTCTGGTGAGTCTCCCATGG - Intronic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1095834893 12:46626841-46626863 GTTTTCAGGAGTGTGTCCAAAGG + Intergenic
1106795747 13:33203137-33203159 GTTGAATGGCGTGGCTCCCAAGG + Intronic
1109873055 13:68362550-68362572 CTTTTCTGGTATGTATCCCATGG + Intergenic
1111196172 13:84876644-84876666 GGTATCTGGCTTCTCTCCCAAGG - Intergenic
1111709661 13:91795648-91795670 ATTTTCTGGCTTGCCTACCATGG + Intronic
1116216030 14:42018274-42018296 GCTTCCTGGCATTTCTCCCAAGG - Intergenic
1118805692 14:69234972-69234994 GTTTTCTGGGGTCTCTCCCTTGG - Exonic
1121442034 14:93955547-93955569 TTTTCCTGGAGTGTCTCCAAAGG + Intronic
1126119089 15:45235133-45235155 GGTGTCTGACGTCTCTCCCAAGG + Intergenic
1131721519 15:95173699-95173721 GTTTTTTGCCCTGTCTCCCAAGG - Intergenic
1133709376 16:8386502-8386524 CCTTTCTGGCGTATTTCCCATGG - Intergenic
1138854806 16:60677476-60677498 ATTTTCTGAAGTGTTTCCCATGG + Intergenic
1140036438 16:71374992-71375014 CTTTTCTTGTGTGTCACCCAAGG + Intronic
1148472299 17:47902489-47902511 GGTTTCTATCATGTCTCCCACGG - Intronic
1149038944 17:52164489-52164511 ATTTTCTGGCCTGCCTCCCCAGG - Intergenic
1149332534 17:55601132-55601154 TTATTATGACGTGTCTCCCATGG + Intergenic
1149642712 17:58214386-58214408 CCTTTCTGTGGTGTCTCCCAGGG - Exonic
1151586341 17:75010982-75011004 CCTTTCTGGCCTTTCTCCCAGGG + Intergenic
1151801253 17:76381274-76381296 GTTCTCAGGTGTGTCTCCCTGGG + Intronic
1152038264 17:77886771-77886793 GGGTTCTAACGTGTCTCCCAGGG + Intergenic
1152928090 17:83097027-83097049 GTTTTCTGGGCTGGCTCCCGGGG + Intergenic
1161542867 19:4862595-4862617 GCTTCCTGACGTGTGTCCCAGGG - Intronic
1162064886 19:8119311-8119333 GCTTTCTGGCGTGTCCTGCAGGG - Intronic
1164513353 19:28914738-28914760 GTCTTCTGGCGTGCCTCCAGTGG + Intergenic
1166196057 19:41206612-41206634 GTTTTCCGGAGTCTGTCCCACGG + Exonic
925300467 2:2808011-2808033 ATTTTCTGGGGTGTCACCGAGGG - Intergenic
925479229 2:4251426-4251448 GATTTCTGCCCTGTCTCACAGGG - Intergenic
928671138 2:33605030-33605052 TTTTTCTACCCTGTCTCCCATGG + Intergenic
933419765 2:82030603-82030625 GGTGTCTGGCTTCTCTCCCAAGG - Intergenic
935126246 2:100225616-100225638 GTTTTCTGTTGTGTTTCCAATGG + Intergenic
935171800 2:100615994-100616016 GTGTTCTGGCTTTTCTCCCTGGG + Intergenic
937886947 2:126906350-126906372 GTGTTCTGACATGTGTCCCAGGG - Intergenic
937924917 2:127160675-127160697 GTTTCCAGGTGTGTCTGCCAGGG + Intergenic
943795782 2:191991791-191991813 GTTTTCCAGAGTGTCTACCAGGG + Intronic
945054691 2:205858336-205858358 TTTTTCTGGCCTGACCCCCATGG - Intergenic
946475392 2:220001886-220001908 TTTTTCTGGTATGTCTCCTAGGG - Intergenic
947814477 2:233026912-233026934 GTTTTCTGGGGTATCTGCCTAGG - Intergenic
1169468826 20:5865133-5865155 GTTTTCTCCAGTGTCTCTCAAGG - Intergenic
1170099322 20:12681341-12681363 GTTTTCTGGAGTGTGTCCCATGG + Intergenic
1176687632 21:9865270-9865292 GTGCTCTGGAGAGTCTCCCAGGG + Intergenic
1179892115 21:44340931-44340953 GGTTTCTTGCATGTCTCACACGG + Intergenic
1185273748 22:49941064-49941086 TTTTTCTGGGGTGACACCCAAGG - Intergenic
950793370 3:15491403-15491425 GTTTTCTGTCTTATCTCCCAGGG + Intronic
950896313 3:16454785-16454807 GTTTTCTGGCGTGTCTCCCAGGG + Intronic
957545703 3:81633812-81633834 GATTTGTTGCGTGTCTCCTAAGG + Intronic
960871920 3:122258751-122258773 GTTCTCTGCCATGTCTGCCATGG + Intronic
965280319 3:166743415-166743437 GTTTTTTAGCCTGGCTCCCATGG + Intergenic
966575515 3:181497659-181497681 TCTTTCTGTCATGTCTCCCAGGG + Intergenic
967049224 3:185766883-185766905 GTTTTCTGACCTATATCCCAAGG + Intronic
969459505 4:7321605-7321627 GTTCTCTGGCCTGTCTCCTTTGG - Intronic
970484598 4:16511924-16511946 GTTTTCAGAGGTGTCTTCCAGGG - Intronic
971252060 4:24981220-24981242 TTCTTCTGGTGTGTCCCCCAAGG + Intergenic
972879725 4:43408442-43408464 GTTTTCTCACCTGTCTGCCATGG + Intergenic
974927753 4:68322072-68322094 GTTTGTTGCCGGGTCTCCCAGGG + Intronic
980350984 4:131683086-131683108 GTGCTCTGGAGAGTCTCCCAGGG + Intergenic
984103711 4:175517923-175517945 GTTTTTGAGCGTGTTTCCCAAGG + Intergenic
987109595 5:14672725-14672747 GTTTTCTGACTTGCCTGCCACGG + Intronic
990539529 5:56758146-56758168 GATTTCTTCCGTGTCTCTCAGGG - Intergenic
991596072 5:68307151-68307173 GTTTTCTGGCTTTTTCCCCAAGG + Intergenic
995478347 5:112570369-112570391 ATTCTCAGGCTTGTCTCCCATGG - Intergenic
1000296758 5:159918864-159918886 ATTTTCTGTAGTGTCCCCCAGGG - Intronic
1002001370 5:176198024-176198046 GGTTTCTGGGGTGGCTCCCTTGG - Intergenic
1002252969 5:177940945-177940967 GGTTTCTGGGGTGGCTCCCTTGG + Intergenic
1003081307 6:3023929-3023951 CCTTTCCGGCGTGTCTCCCGAGG - Intergenic
1008223219 6:48879048-48879070 GGTGTCTGGCTTCTCTCCCAAGG - Intergenic
1012416760 6:99021050-99021072 GTTTGCTGGGTTGTGTCCCAAGG + Intergenic
1014287339 6:119515051-119515073 GTTTTGGGGAGTCTCTCCCATGG + Intergenic
1016521182 6:144948702-144948724 GTTTCCAGGCCTCTCTCCCATGG - Intergenic
1019557598 7:1640530-1640552 GTTTCCTGCCGTGTCTCGGAAGG + Intergenic
1023649317 7:42351993-42352015 GTTTTGTGGGGTGCCTCCCTGGG + Intergenic
1030875424 7:114807573-114807595 GTTTTCTGTCCTGTCCCCCTAGG - Intergenic
1032415036 7:131729324-131729346 CATTTCTGGCATGTGTCCCACGG + Intergenic
1033025595 7:137769163-137769185 ATTTTCTCCCGTGTCTCCCTTGG - Intronic
1033269379 7:139916871-139916893 GTTTTATGGCAAGTCTGCCAAGG - Intronic
1034367254 7:150561662-150561684 GGTGTCTGGCTTCTCTCCCAAGG + Intergenic
1037141938 8:15530938-15530960 GTTTTCTGGGGTGACACCCGAGG - Intronic
1043295246 8:78653998-78654020 GGTGTCTGGCTTCTCTCCCAAGG - Intergenic
1044904838 8:96989938-96989960 GTTTTCTGACTTGTGGCCCAGGG + Intronic
1048868857 8:138780935-138780957 CTTTGCTGCCGTCTCTCCCAGGG + Exonic
1049877159 8:145032069-145032091 GGTGTCTGGCTTCTCTCCCAAGG - Intergenic
1052138952 9:24953965-24953987 TATTTCTAGGGTGTCTCCCAAGG + Intergenic
1054169672 9:61826783-61826805 GTGCTCTGGAGAGTCTCCCAGGG - Intergenic
1054667866 9:67754032-67754054 GTGCTCTGGAGAGTCTCCCAGGG + Intergenic
1057230438 9:93318489-93318511 GTTTTCTGGCGGATTTCTCATGG - Exonic
1061383555 9:130275216-130275238 GTCTTCTGGAGTTTCTCCCTGGG + Intergenic
1062420105 9:136476581-136476603 GTTTTCTGGGCTATCTCCCCGGG + Exonic
1189329988 X:40138385-40138407 GTTTTCTTGGGTCTCTCTCATGG + Intronic
1192093928 X:68190143-68190165 GTCCTCTGGCGTGTCTCACTGGG - Intronic
1196985116 X:121260865-121260887 GTTCTCTGTGGTGTGTCCCAAGG + Intergenic
1200151675 X:153954311-153954333 GTGGTCTGGTGTGTCTCACAGGG + Exonic