ID: 950896862

View in Genome Browser
Species Human (GRCh38)
Location 3:16460568-16460590
Sequence CATTTCAAGCAGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950896855_950896862 1 Left 950896855 3:16460544-16460566 CCGCTGTCCAAAACCAAAACCTC 0: 1
1: 0
2: 3
3: 19
4: 236
Right 950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 253
950896854_950896862 7 Left 950896854 3:16460538-16460560 CCAACGCCGCTGTCCAAAACCAA 0: 1
1: 0
2: 0
3: 5
4: 46
Right 950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 253
950896856_950896862 -6 Left 950896856 3:16460551-16460573 CCAAAACCAAAACCTCACATTTC 0: 1
1: 1
2: 2
3: 48
4: 429
Right 950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950896862 Original CRISPR CATTTCAAGCAGAGGCTGGG TGG Intronic
901369461 1:8784056-8784078 CATTACAAGCACATGCTTGGTGG - Intronic
901575075 1:10194058-10194080 GATTTCAATGAGAGGCTGTGTGG - Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
904893942 1:33800139-33800161 CATTGTAAACTGAGGCTGGGTGG - Intronic
906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG + Intergenic
907106658 1:51889032-51889054 CATTTAAAGCTTAGACTGGGGGG - Intergenic
907285450 1:53376812-53376834 CATTTCCAGCAGCGGAGGGGTGG - Intergenic
907372309 1:54011386-54011408 GGATGCAAGCAGAGGCTGGGTGG + Intronic
910003976 1:82372232-82372254 CTTTTCAAGCAGAGACAGGTTGG + Intergenic
910540443 1:88349879-88349901 CAATTCAAGATGAGACTGGGTGG + Intergenic
910842665 1:91575656-91575678 AATTTGCAGCAGTGGCTGGGGGG + Intergenic
911721108 1:101192159-101192181 AATTTGAAGCAGAGGGTGGGTGG + Intergenic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914426387 1:147581005-147581027 GATTTGAAGAAGAGGCAGGGAGG - Intronic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914814381 1:151052843-151052865 GATGTCAAGCAGGGGCTGGTGGG - Exonic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
917215409 1:172673073-172673095 GTTTTCAAGCAGAGGTTGTGTGG - Intergenic
918113567 1:181478899-181478921 CTTTTCCAGAAGAGGCTGGAGGG + Intronic
922236565 1:223726762-223726784 CATTTGTATCAGGGGCTGGGAGG - Intronic
922819823 1:228476586-228476608 CAGTTCAAACAGGAGCTGGGAGG + Intergenic
923038264 1:230300734-230300756 CATTTGAAGCAGAGGTGGTGTGG + Intergenic
924587903 1:245376065-245376087 CATTCCAAGCTGGGGGTGGGAGG + Intronic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1064282237 10:13961343-13961365 AATTTCCATCTGAGGCTGGGCGG + Intronic
1064310232 10:14205854-14205876 CAAATCAAGCAGAGGCCTGGAGG - Intronic
1064476519 10:15695997-15696019 AATTTCACGCAGAGTCTGGCAGG - Intronic
1066659447 10:37726328-37726350 CGTTGCAAGAAGAGGGTGGGGGG - Intergenic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1070310912 10:75273214-75273236 CTTCTCCAGCGGAGGCTGGGAGG + Intergenic
1070480811 10:76881029-76881051 CATTTCAGTCTGTGGCTGGGAGG + Intronic
1071538881 10:86461007-86461029 CATTTAAAGAAGAGGCCGGCCGG - Intronic
1072475502 10:95756175-95756197 CACAGCAAGCAGAGGCTGGGGGG + Intronic
1072742977 10:97921354-97921376 CATTTCACCCAGGGGCAGGGAGG + Intronic
1074361899 10:112830377-112830399 CATTCCAGGCAGAGGCTCTGAGG - Intergenic
1075097401 10:119481589-119481611 GCATTCGAGCAGAGGCTGGGTGG - Intergenic
1075544539 10:123345014-123345036 CAGTAAAAGCAGTGGCTGGGAGG - Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1078729127 11:13959984-13960006 CAGATCAAGCAGAGCCTTGGAGG + Intergenic
1079984028 11:27181109-27181131 GATTTCAAACAGAGGATGGAGGG + Intergenic
1080097318 11:28424649-28424671 CATTTAAAGCACAGGTTGGCAGG - Intergenic
1083261141 11:61523796-61523818 CTTCTCCAGCAGAGGATGGGCGG - Intronic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1085211335 11:74782180-74782202 CATTTCAGGCAGAGGCATAGAGG + Intronic
1085257248 11:75182118-75182140 GATTTGAAGCAGAGGCACGGTGG - Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1085472517 11:76767366-76767388 GTTTTCAAGCAGAAGCTGGGTGG + Intergenic
1087906965 11:103709657-103709679 ATGTTGAAGCAGAGGCTGGGTGG - Intergenic
1089305795 11:117525295-117525317 GATTCCCAGCAGGGGCTGGGAGG + Intronic
1090976549 11:131684672-131684694 CTTCTCAAACAGAGGCAGGGAGG - Intronic
1096504558 12:52084625-52084647 CATTTCAGGCAGAGATTTGGAGG + Intergenic
1097042439 12:56163851-56163873 CATGGCATGCAGTGGCTGGGTGG + Intronic
1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG + Intergenic
1101125944 12:101633767-101633789 GATGTCAAGCAGAGGCTGGATGG + Intronic
1104215247 12:126727453-126727475 GATTGCAAGGAGGGGCTGGGGGG + Intergenic
1104644512 12:130487254-130487276 CATTTCAACCTGAGGTTTGGAGG - Intronic
1105435565 13:20375024-20375046 CATGACAAGCAGAGCCAGGGAGG + Intergenic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1106466929 13:30021792-30021814 CATTTCAGGCTGGAGCTGGGAGG - Intergenic
1108035963 13:46290959-46290981 GATTTCATGCAGAGGCAGGGAGG + Intergenic
1108352040 13:49596618-49596640 CTTGTCGAGCAGAGGGTGGGGGG + Intergenic
1108785154 13:53891477-53891499 CAATTTAAGAAGTGGCTGGGAGG + Intergenic
1112932868 13:104763367-104763389 CATTTCAACCTGAGGTTTGGAGG - Intergenic
1114597266 14:23924279-23924301 CTTTTCAACAGGAGGCTGGGAGG - Intergenic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115842486 14:37487984-37488006 CATTTAAAGCAGTGTCTAGGGGG - Intronic
1115979517 14:39034675-39034697 CATTTCAAGCAGGAGCTCTGTGG - Intronic
1118203697 14:63701654-63701676 CAGATCAAGTAGAGCCTGGGAGG + Intronic
1121845883 14:97171680-97171702 CATTTAAAGCAGTGTGTGGGAGG - Intergenic
1124028035 15:25984900-25984922 CACTTGAAGCAGTGGATGGGAGG - Intergenic
1124503962 15:30255755-30255777 CATTTAAAGCAGAGGAGAGGAGG + Intergenic
1124739592 15:32282885-32282907 CATTTAAAGCAGAGGAGAGGAGG - Intergenic
1126316189 15:47372528-47372550 CATTTGCAGCAGAGGCAGGAAGG - Intronic
1126398356 15:48243273-48243295 GCATTCAAGCAGAGGCTGGCAGG + Intronic
1127067512 15:55256091-55256113 CAAGTCAAGTAGAGGCTGGGAGG + Intronic
1127232393 15:57011166-57011188 CATTTCAAATAGAGGTTTGGAGG - Intronic
1128826891 15:70726921-70726943 AATCTCAAGCAGAGGATGAGTGG + Intronic
1132292857 15:100715392-100715414 CTTCTCCAGCAGAGGCTGGGAGG - Intergenic
1132426109 15:101718662-101718684 CATATGAAGCAGAGGCTTGTGGG - Intronic
1132525424 16:411798-411820 CATTTCTGGCAGGTGCTGGGTGG + Intronic
1134043623 16:11085900-11085922 CATTTCAACCTGAGATTGGGCGG + Intronic
1134069789 16:11253986-11254008 CATTTCAAGCAGATGTTTAGTGG + Intronic
1135379959 16:21987598-21987620 TATTTCAAGAAGAGAGTGGGTGG + Intronic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1138140544 16:54564702-54564724 CATTTAAATCAGAGACAGGGAGG + Intergenic
1138757036 16:59500278-59500300 CATTTTAAACAGAGGCTGTCAGG - Intergenic
1141583697 16:85018761-85018783 TATTTCAAGTAGATGCTGGCAGG + Intergenic
1141656542 16:85419773-85419795 CATTTCCATCAGAGTCTTGGAGG - Intergenic
1142422373 16:89979786-89979808 CATTACAGGAAGAGGCTGGTAGG + Intergenic
1142687425 17:1585825-1585847 CATGTCAGGCACAGGGTGGGTGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143280104 17:5747571-5747593 AACTTCAAGGAGTGGCTGGGAGG + Intergenic
1145016144 17:19399578-19399600 CATTTGAACCAGAGGGTCGGAGG + Intergenic
1146682145 17:34816100-34816122 CATTTTAAGCAGAGGGCTGGGGG - Intergenic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1148763317 17:50020842-50020864 TAATACAAGCACAGGCTGGGAGG - Intergenic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1150248341 17:63692252-63692274 CATTCCCAGCAGAGTCTCGGAGG - Exonic
1151890835 17:76949546-76949568 CAATTCAACCAGGGTCTGGGTGG - Exonic
1152170107 17:78740286-78740308 CCTTTAAGGCAGAGGCTGTGGGG - Intronic
1155379288 18:25201346-25201368 TATTTGAAGCAGGGCCTGGGAGG - Intronic
1159486816 18:69071763-69071785 CATTTTATGCAGACGCTCGGAGG + Intergenic
1159599404 18:70414275-70414297 GATGCCAAGCAGAGGATGGGAGG - Intergenic
1159772980 18:72569855-72569877 CATTTCAACAAGAGGTTTGGAGG + Intronic
1161069995 19:2255287-2255309 CATGACAACCAGAGCCTGGGAGG - Exonic
1162136069 19:8555919-8555941 CATCTCCAGGAGAGGCTGGCAGG + Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1163817475 19:19475575-19475597 AACTTCCAGGAGAGGCTGGGTGG + Intronic
1164805441 19:31112729-31112751 CATTTGATGCAGAGTCTAGGCGG + Intergenic
1164809995 19:31148093-31148115 CATTTCACTCAGTGGGTGGGTGG + Intergenic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
926054296 2:9765375-9765397 GAGTTTTAGCAGAGGCTGGGTGG + Intergenic
926056348 2:9776256-9776278 CATCTCTAGCCAAGGCTGGGGGG - Intergenic
926168055 2:10533950-10533972 CATTTCAATCAGAGACCTGGAGG + Intergenic
927231305 2:20826662-20826684 CATTTCAATCTGAGACTTGGTGG - Intergenic
929752406 2:44729493-44729515 CATTTCAAGGAGAGTGTGGTTGG + Intronic
930075138 2:47400433-47400455 GATTCCAGGCTGAGGCTGGGCGG + Intergenic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
931218160 2:60265204-60265226 CATTTCAAGTAGAGGACGTGAGG + Intergenic
931855900 2:66301625-66301647 AAATGCAAGCTGAGGCTGGGTGG + Intergenic
932099551 2:68885299-68885321 CATTTCAAGCAGATACTCTGTGG - Intergenic
932403173 2:71496122-71496144 CATATGAAGAGGAGGCTGGGAGG - Intronic
936520077 2:113206333-113206355 CATTTCAGGCAAAGGTGGGGTGG - Intronic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937625504 2:124038927-124038949 CAATACAAGCAGAGGCAGGTGGG - Intronic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938804596 2:134794495-134794517 CTGTTCCAACAGAGGCTGGGAGG + Intergenic
939577945 2:143918458-143918480 CAATTCAAGATGAGACTGGGTGG - Intergenic
940391224 2:153134779-153134801 AATATCAAGCAAAGCCTGGGAGG - Intergenic
940634115 2:156276527-156276549 AGTTTTAAGCAGAGGCCGGGTGG - Intergenic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
940885317 2:158984796-158984818 CGTAAGAAGCAGAGGCTGGGAGG + Intronic
943698828 2:190967002-190967024 CATTAAAGGCAGAGACTGGGGGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
944502083 2:200372289-200372311 CTGTTCAAGCAGAAGCTGGCTGG - Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
948318109 2:237045779-237045801 CATTTCAAGCATGACCTGGGAGG + Intergenic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948395669 2:237643260-237643282 CATTTCTAGCAAATTCTGGGTGG - Intronic
948556584 2:238815427-238815449 CAACTCAAGCAGAGGCTGCATGG + Intergenic
1170272276 20:14540591-14540613 CATTTCAATCAGAGACTGGCAGG - Intronic
1171201046 20:23242437-23242459 CAGTTGCAGCAGAGACTGGGTGG - Intergenic
1171294231 20:24003690-24003712 CCTGGCAAGCAGAGGCAGGGCGG - Intergenic
1172038832 20:32029634-32029656 CCTTTCAGGCAGGGGTTGGGTGG + Intronic
1172903505 20:38351549-38351571 CATAACAAGCATAGACTGGGTGG + Intronic
1173472456 20:43334357-43334379 CATTTCAAACAGGGGCTTTGGGG + Intergenic
1177826641 21:26091701-26091723 CACTTCAAGCTGAGGTAGGGGGG + Intronic
1178505544 21:33159817-33159839 CATTGCAAGCAGCAGGTGGGAGG + Intergenic
1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG + Intronic
1181691772 22:24566581-24566603 GTGTTCAAGCAGAGGCTGGGTGG + Intronic
1182031415 22:27162208-27162230 CACTTCATGCACAAGCTGGGAGG + Intergenic
1183083573 22:35472893-35472915 CAGCTCGAGCAGAGGCTGGCAGG - Intergenic
1184302148 22:43567867-43567889 CATTTCCAGCACCGGCTGGCAGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1184751805 22:46490577-46490599 CTTTTCAAGCAGGACCTGGGAGG + Intronic
1185034606 22:48465826-48465848 CATGTTAAGCAGAGACTTGGAGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185215847 22:49599643-49599665 CATTTCAAGCAGTGGCTCCCAGG - Intronic
1185253797 22:49820479-49820501 TATTCCCAGCTGAGGCTGGGAGG + Intronic
949232450 3:1767138-1767160 CGTTTCAAGCATAGTCTGGGTGG + Intergenic
950710950 3:14812289-14812311 CTTTCCAAGCAGTGGCTGGCTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951528830 3:23679910-23679932 CATTTCAAACCGAGGCCGAGGGG + Intergenic
951902806 3:27673753-27673775 CATTTCAAGGTGAGATTGGGTGG - Intergenic
953063580 3:39448807-39448829 AATTTCAACCTGAGGCTTGGAGG + Intergenic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954621949 3:52001530-52001552 CATTTCCAGCAGAAACTGGAAGG + Intergenic
955798944 3:62666606-62666628 GAGGTCAAGCAGAGGCTGTGTGG + Intronic
956319170 3:67976373-67976395 AATTTCATGGAGAGGCTGGAAGG - Intergenic
956615134 3:71163382-71163404 TATTTCAAACAGATGCTGAGGGG - Intronic
957590113 3:82185881-82185903 CATTTCCACAAGAGGCTGGGTGG - Intergenic
958098895 3:88983514-88983536 CATTTCTAGCAGTGGTGGGGAGG - Intergenic
961988066 3:131158424-131158446 CATTGCAATCAGAGCCTTGGCGG + Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
963557318 3:146808949-146808971 GAACTCAAGCAGAGGCTGTGAGG + Intergenic
967111156 3:186295208-186295230 CATTTAAAATATAGGCTGGGCGG + Intronic
968440022 4:618602-618624 CATTTCAACATGAGGCTTGGAGG + Intergenic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
970309676 4:14768855-14768877 CATTTGTAGCAGATGCTGCGGGG - Intergenic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
972175489 4:36400381-36400403 CATTTAGACCAGAGACTGGGAGG + Intergenic
974585043 4:63863204-63863226 CATTTAAAGCAGTGTTTGGGGGG - Intergenic
977404062 4:96574043-96574065 CAATTCAAACAGAGGCTGGCAGG + Intergenic
979742997 4:124174709-124174731 CATTTCAAGTAGATGCAAGGAGG + Intergenic
980786429 4:137562048-137562070 CAAATCAAGCAGAGGCTGAAGGG - Intergenic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
991102887 5:62812736-62812758 CATCGCACGCAGATGCTGGGTGG - Intergenic
991268021 5:64745651-64745673 CATTTCAATGAGAGGATGAGAGG - Intronic
994138769 5:96319309-96319331 CATTTCAACATGAGACTGGGAGG + Intergenic
994164243 5:96592221-96592243 TATTTCTAGCAGAGACAGGGTGG - Intronic
994808034 5:104477636-104477658 CATTACAAGTAGGGGATGGGTGG + Intergenic
995030283 5:107472996-107473018 GAGTTCAAGCAGGTGCTGGGGGG - Intronic
995097764 5:108259544-108259566 CATTTCTAACTGAGGCTGTGTGG - Intronic
996647523 5:125834549-125834571 CATAGCAAGCAAAAGCTGGGAGG - Intergenic
999136205 5:149321032-149321054 CATTCCAATCAGACGCTGGTGGG + Intronic
999323975 5:150631728-150631750 CACCTCAAGAAGTGGCTGGGGGG - Intronic
999806397 5:155085441-155085463 CATTTCTAGCAGCTTCTGGGTGG - Intergenic
1000104119 5:158042566-158042588 CATTTCCAGTAGTGGATGGGTGG + Intergenic
1000250537 5:159490588-159490610 GATTATAAGCAGAGGCTAGGAGG - Intergenic
1000323875 5:160157266-160157288 CATTTCAGGCACATGCTGGTAGG - Intergenic
1001445209 5:171777538-171777560 TGTGGCAAGCAGAGGCTGGGAGG - Intergenic
1001530911 5:172461042-172461064 CATTTTAAGCAAAGGTGGGGTGG - Intergenic
1001734154 5:173985127-173985149 CAATTCAAGACGAGACTGGGTGG + Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1001927494 5:175649184-175649206 CATTTCAACATGAGGCTTGGAGG + Intergenic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002560595 5:180079488-180079510 CATTTAGTGCAGAGCCTGGGAGG - Intergenic
1002704594 5:181151709-181151731 CAGTTGAAGCTGGGGCTGGGAGG + Intergenic
1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG + Intergenic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1013145901 6:107391474-107391496 TATTCCAAGCAGGGGATGGGGGG + Intronic
1013716961 6:112973615-112973637 CATTTCAATCAGATGCTGGAAGG - Intergenic
1014692189 6:124575540-124575562 CACTTCATGCAGAAGCAGGGTGG - Intronic
1016276025 6:142353427-142353449 GATTTCAGGGAAAGGCTGGGAGG - Intronic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1016799303 6:148152784-148152806 CTTTTCATGGGGAGGCTGGGGGG + Intergenic
1020272859 7:6607414-6607436 CATCTGAAGCTGAGGCTGCGCGG + Intronic
1020375763 7:7484352-7484374 CATTTCAACCAAAGGCTGAAAGG + Intronic
1021537612 7:21723091-21723113 CATTTAAAACAGAGGCTATGAGG + Intronic
1026376645 7:69758192-69758214 CATTGCAAACACAGCCTGGGTGG + Intronic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1029241767 7:99168269-99168291 CACTTCAAACAGACTCTGGGGGG - Intergenic
1033149451 7:138900579-138900601 CATTTCAACCAGAGAGTTGGAGG - Intronic
1034110746 7:148535506-148535528 CATTTCTGCCAGAGCCTGGGGGG + Intergenic
1034987868 7:155528525-155528547 CAAGTCCAGCAGAGGGTGGGTGG + Intronic
1035161359 7:156952462-156952484 CTTTTCAAGCAGAGTCTTTGTGG + Exonic
1036202526 8:6781096-6781118 CATTTCAACATGAGGCTTGGAGG + Intergenic
1036205243 8:6800840-6800862 CCTTTCAAGCACAAGCTTGGAGG - Intergenic
1036581087 8:10076666-10076688 AGAGTCAAGCAGAGGCTGGGAGG + Intronic
1037484622 8:19335605-19335627 ATTTTCAAGCACAGGCTGAGGGG + Intronic
1037718346 8:21419031-21419053 CATTCCAAAAAGCGGCTGGGAGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038363921 8:26911639-26911661 AATTTCCATCAGAGGCTTGGGGG + Intergenic
1039439759 8:37586872-37586894 CATTTAAAGAAGAGGCTAGAAGG + Intergenic
1040463217 8:47670028-47670050 CATTTAAAGCAAAGTCTTGGGGG + Intronic
1043251767 8:78083780-78083802 GAGTTAAAGCAGTGGCTGGGAGG + Intergenic
1043498197 8:80825916-80825938 CATTTAAAGCAGTGTCTGGAGGG + Intronic
1044865926 8:96571293-96571315 CATTTCAGGCAGAGGCAGAGCGG + Intronic
1045695815 8:104807595-104807617 AATTTAAAGCAGAGGCAGGGAGG - Intronic
1046335186 8:112776926-112776948 CTTTTACAGCAGAGGTTGGGAGG - Intronic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG + Intergenic
1047513124 8:125530615-125530637 CATCACAACCAGGGGCTGGGGGG - Intergenic
1048208561 8:132435371-132435393 CAGTTCAGCCAGAGGCGGGGAGG + Intronic
1048393423 8:133989409-133989431 CATTTCAAGCAGAGAAGGAGAGG - Intergenic
1049244634 8:141555695-141555717 CAATTCAAGATGAGACTGGGTGG - Intergenic
1050082926 9:1934225-1934247 CATTTAAAGCAGTGTGTGGGGGG - Intergenic
1050153123 9:2637520-2637542 CATTTGGAGCATAGACTGGGAGG - Intronic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1050320102 9:4443688-4443710 CAGTTCAAGAAGTGGCTGTGGGG + Intergenic
1050948009 9:11550293-11550315 CATGGCAAGCAGGGGATGGGAGG - Intergenic
1052129380 9:24823238-24823260 CATTTTAACCAAAAGCTGGGGGG + Intergenic
1055453360 9:76451254-76451276 TATTGCAAGAAGAGGATGGGTGG + Intronic
1056832862 9:89930848-89930870 CATAGGAAGCAGAGGCTGCGTGG + Intergenic
1057083601 9:92189775-92189797 CGTTTGAAGCAGAGGGTGTGGGG - Intergenic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1185477580 X:424660-424682 TATTTTTAGCAGAGGCGGGGGGG - Intergenic
1185632866 X:1528300-1528322 CATTTCAACCACTGGCTGAGAGG + Intronic
1186690850 X:11974152-11974174 GATTTCAACGTGAGGCTGGGAGG - Intergenic
1186979481 X:14943976-14943998 CATTTAAATCAGAGTCTGGTGGG - Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1192714773 X:73627871-73627893 CATTACCAGCAGTGGCTGTGGGG - Intronic
1195458759 X:105099902-105099924 CATTTCAACCTGAGGTTTGGAGG + Intronic
1195580560 X:106496497-106496519 CATTTCAAGCTGAGTTTTGGTGG - Intergenic
1197198775 X:123731294-123731316 CATTCTAAGCATAGGCTGGGGGG + Intronic
1197354354 X:125418577-125418599 CAAAACCAGCAGAGGCTGGGTGG + Intergenic
1198672024 X:139091326-139091348 CTCTGCAAGCAGAGGGTGGGAGG + Intronic
1199845887 X:151692988-151693010 CTTGTCAAGCTGAGGCTGGAGGG - Intergenic
1200695412 Y:6354333-6354355 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1200710823 Y:6483465-6483487 CATTTCAGCCTGAGGCTTGGAGG + Intergenic
1200779054 Y:7197853-7197875 CATTTGACCCAGAGGCTGTGGGG + Intergenic
1200842574 Y:7798112-7798134 CATTTCAGACAGAGGCTAGGTGG + Intergenic
1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG + Intergenic
1200908202 Y:8507454-8507476 CATTTCAACCTGAGGCTTGGTGG - Intergenic
1200953292 Y:8921345-8921367 CATTTCAACCTAAGGCTTGGAGG - Intergenic
1201023114 Y:9678521-9678543 CATTTCAGCCTGAGGCTTGGAGG - Intergenic
1201039865 Y:9820377-9820399 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1201058469 Y:10019114-10019136 CATTTCAGCCTGAGGCTTGGAGG + Intergenic
1202198735 Y:22325135-22325157 CATTTCAACCTGAGGCTTGGAGG - Intronic
1202231381 Y:22662703-22662725 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1202311777 Y:23533462-23533484 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1202559025 Y:26137132-26137154 CATTTCAACCTGAGGCTTGGAGG - Intergenic