ID: 950899712

View in Genome Browser
Species Human (GRCh38)
Location 3:16486560-16486582
Sequence GCTGTTAGTCAGGCAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950899712_950899714 -10 Left 950899712 3:16486560-16486582 CCATCTTTTGCCTGACTAACAGC 0: 1
1: 0
2: 1
3: 17
4: 160
Right 950899714 3:16486573-16486595 GACTAACAGCCAACTGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 88
950899712_950899719 26 Left 950899712 3:16486560-16486582 CCATCTTTTGCCTGACTAACAGC 0: 1
1: 0
2: 1
3: 17
4: 160
Right 950899719 3:16486609-16486631 TAAAACTCCAAATCCACCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950899712 Original CRISPR GCTGTTAGTCAGGCAAAAGA TGG (reversed) Intronic
902777671 1:18684997-18685019 GCTTTTCCTCTGGCAAAAGAGGG + Intronic
902899081 1:19501616-19501638 GCAGTTATTCAGGTAAGAGAGGG - Intergenic
903430954 1:23299370-23299392 ACTTTAAGTCAGGCAGAAGAGGG + Intergenic
904010412 1:27386576-27386598 GCAGTCATTCAGGCAAGAGATGG - Intergenic
907391438 1:54160844-54160866 GCTGGGAGTCAGGCAAAGAATGG + Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
908788968 1:67762152-67762174 GGTGGTGGTCAGGCAAAAGAAGG - Intronic
910152858 1:84173732-84173754 GCTTTTATTAAGGTAAAAGAGGG + Intronic
911438464 1:97894151-97894173 GCTGTGAGTGAGTCAGAAGAGGG - Intronic
916602605 1:166307652-166307674 GCTGTTAGGCAGGCAGAGGAGGG - Intergenic
916922866 1:169486823-169486845 GCTGTGAGTCAGGCAGAAAAAGG - Intergenic
918207794 1:182324819-182324841 GATGTAAGTCAGGCAAAGAAAGG - Intergenic
919258922 1:195163655-195163677 GCAGTTATTAAGGCAAAAGCTGG - Intergenic
919876480 1:201872944-201872966 GCTCTAAGTCAGCCAAAAGTGGG + Exonic
921973488 1:221176291-221176313 GCTTTGATCCAGGCAAAAGAAGG + Intergenic
1064564712 10:16627899-16627921 GCAGTTAGTCAAGCAACAGGAGG - Intronic
1071275085 10:84046501-84046523 GCTCTTAGTCAGATAAGAGAAGG + Intergenic
1075567194 10:123513306-123513328 TCTGTCAGGCAGGCAAAACAGGG + Intergenic
1076288047 10:129320615-129320637 GCTGTTCAGCAGTCAAAAGAAGG - Intergenic
1077119904 11:902322-902344 GCTGTTCCACTGGCAAAAGATGG + Exonic
1078418556 11:11187311-11187333 GATGTTAGTCTGACAAATGAAGG + Intergenic
1081708753 11:45203293-45203315 GCTGTTAGAAAGGAAAAAGAAGG + Intronic
1083738645 11:64695893-64695915 GCTGATAGACAGGAACAAGAAGG - Intronic
1084072168 11:66743834-66743856 GCTGGTTGTAAGGTAAAAGACGG + Intergenic
1085905639 11:80758623-80758645 GATTTTAGTCAGACAAAAGAAGG + Intergenic
1085951535 11:81338332-81338354 GATGTGAGTATGGCAAAAGAGGG + Intergenic
1086012372 11:82120812-82120834 GCTGATACCCAGGCAAAACAGGG + Intergenic
1086013680 11:82137793-82137815 GCTGCTAGGGAGGCAAAAGATGG + Intergenic
1088563812 11:111146148-111146170 GGTCTTAGTCAGGGAAAGGAGGG - Intergenic
1088799904 11:113296300-113296322 TCTGTGAGACAGGCAAAAAACGG + Intergenic
1088999527 11:115039948-115039970 GCTGTAGGTCAGGCATAACATGG + Intergenic
1090406192 11:126477010-126477032 GTTGTCAGTCAGGAAAAAAATGG + Intronic
1095653953 12:44647697-44647719 GCTGTTTGTTAAGCAACAGAAGG + Intronic
1098085729 12:66840802-66840824 CTTGTCAGTCAGGCAATAGAGGG - Intergenic
1098426699 12:70372452-70372474 CCTGTAGGACAGGCAAAAGATGG + Intronic
1100147234 12:91692820-91692842 GCAGGTAGTCAGGTGAAAGATGG - Intergenic
1103210973 12:119166186-119166208 GGTGTTGGTCAAGCAAAGGAAGG + Intergenic
1105029426 12:132872578-132872600 GCTGTCAGTCAGGGAGAAGTGGG - Intronic
1105922672 13:24979933-24979955 GCTGTTTTTAAAGCAAAAGATGG + Intergenic
1106957200 13:34953459-34953481 GCTGTTCTTTAGACAAAAGATGG - Intronic
1107585739 13:41846338-41846360 CCTGTTAGTCAGCCACATGAGGG + Intronic
1109048319 13:57441850-57441872 GAAGTGAGTCAGACAAAAGAAGG - Intergenic
1117196069 14:53341381-53341403 GCTGCTTCTCAGGCAAAGGAAGG + Intergenic
1117705129 14:58457915-58457937 GCTATTATTCGTGCAAAAGATGG + Exonic
1117943317 14:60992041-60992063 TCTGTTACTCAGGTAGAAGAAGG + Intronic
1120067221 14:80056780-80056802 GCTGTTAGTCTCACTAAAGAGGG - Intergenic
1121044207 14:90776098-90776120 GCAGTTAGTCAGGCATGAGCAGG + Intronic
1124460401 15:29885095-29885117 GCTGGGAGTCAGGGAAAAGCAGG - Intronic
1125906526 15:43398040-43398062 GATGCTACTCAGGCAAGAGAAGG + Exonic
1131312215 15:91301108-91301130 GCTGTGAGTCATGAAAAGGAGGG + Exonic
1139964184 16:70736520-70736542 GCTGACAGTCTGGCTAAAGATGG + Intronic
1141267456 16:82509741-82509763 GCTAATAGTCAGGCAAATAAGGG - Intergenic
1144300346 17:13917581-13917603 ACTGTTAGTGAGGAAAGAGAAGG + Intergenic
1150617648 17:66784675-66784697 GCTGTTAGGCAGGGAAGATACGG + Intronic
1152607410 17:81299682-81299704 GCTGTGAGCCAGGGAACAGAAGG - Intergenic
1153702722 18:7712198-7712220 GCTGGTACCCAGGCAAAACAGGG + Intronic
1154500362 18:14992979-14993001 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
1155720413 18:29004197-29004219 TGTTTTAGTCAAGCAAAAGAAGG - Intergenic
1156011399 18:32501440-32501462 GCTGGTTGTCAGGGAAAAGGAGG + Intergenic
1157719097 18:49909791-49909813 TTTGTCAGGCAGGCAAAAGAGGG + Intronic
1157913936 18:51645885-51645907 GCTTTTAGTCAGCTAATAGAGGG - Intergenic
1158194227 18:54866603-54866625 GCTGTCTGCCAGGTAAAAGAAGG - Intronic
1158504548 18:58034929-58034951 GCTGTTAGCCAGGGAATACAAGG + Intergenic
1159794076 18:72821084-72821106 GCTGTTTCCCAGGCAAGAGATGG - Intronic
1160418512 18:78728228-78728250 GCCTTGGGTCAGGCAAAAGAAGG - Intergenic
1162288699 19:9761769-9761791 GCTGGTAGTAAGCAAAAAGATGG + Intronic
1162786333 19:13037189-13037211 GCTGTGTGTCAGGGAGAAGAGGG + Intronic
1164950581 19:32333468-32333490 GCGGTTAGTGAGGCACATGAAGG + Intergenic
925857898 2:8148356-8148378 TCTGTAAGTCAGGGTAAAGATGG - Intergenic
928315066 2:30238489-30238511 TCTGTCAGTCAGGCAAGCGAGGG + Intronic
928683286 2:33725019-33725041 GCTGTTAATCATAGAAAAGAAGG - Intergenic
928945050 2:36764726-36764748 GCTGTGATTCCTGCAAAAGACGG + Intronic
930340952 2:50113739-50113761 GCTGTGAGTGAGGCAGAAGGAGG + Intronic
930562937 2:52983352-52983374 GCAGTAATTCAGGCAAGAGACGG + Intergenic
934165612 2:89291394-89291416 GCAGTTAGACAGGCATGAGATGG + Intergenic
934201665 2:89891068-89891090 GCAGTTAGACAGGCATGAGATGG - Intergenic
935965153 2:108465511-108465533 GATGTTAGAGATGCAAAAGAGGG - Intronic
936816317 2:116465240-116465262 GCTGATAGTCAAGTAAAATAAGG + Intergenic
938499565 2:131823324-131823346 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
938910585 2:135882128-135882150 GCAGTAAGGCAGGGAAAAGAGGG - Intergenic
940000779 2:148964683-148964705 GCAGTTAGCCAGGCAAAATAGGG + Intronic
943376459 2:187083495-187083517 GCTGTAAGGAAGACAAAAGATGG + Intergenic
943934921 2:193903927-193903949 GCTGTGAGCCAGGCAGAAGACGG + Intergenic
945537211 2:211032616-211032638 GGTTTTAGTCAGGCAAAACCAGG - Intergenic
945595777 2:211789658-211789680 GGTGTTAGTGAGGAAGAAGAGGG + Intronic
1173533788 20:43792635-43792657 GCTGGTAGCCAGGCAGAAGATGG + Intergenic
1174696105 20:52560615-52560637 GCTGTTTCTCAGGCCCAAGATGG + Intergenic
1178130630 21:29568966-29568988 GATGGTAGGTAGGCAAAAGATGG - Intronic
1181743190 22:24937623-24937645 GCTGTAATCCAGGCAAGAGATGG + Intronic
1183728431 22:39602758-39602780 GCTTCTAGTCAGGAAAAAGAAGG - Intronic
1184254132 22:43277410-43277432 GCACTAACTCAGGCAAAAGACGG + Intronic
949093124 3:53321-53343 GTTATTAGACTGGCAAAAGAAGG + Intergenic
949642248 3:6049905-6049927 ACAGCTAGTCAGGCAAAAGGAGG + Intergenic
950899712 3:16486560-16486582 GCTGTTAGTCAGGCAAAAGATGG - Intronic
951497007 3:23340708-23340730 CCTGTAAGTCAGTCAAAACAGGG + Intronic
952567499 3:34676637-34676659 GCTGTTGGTCAGGGTGAAGATGG - Intergenic
953785793 3:45910223-45910245 GCAGTTGTTCAGGAAAAAGATGG + Intronic
955163595 3:56489011-56489033 GCTGTTATTCATGCAGAAGCGGG - Intergenic
955519586 3:59762024-59762046 GCTGTTATTAAGGAAAATGAAGG + Intronic
956538308 3:70304680-70304702 GCTGTTGGCCATGCAAAAGATGG - Intergenic
961258808 3:125582550-125582572 GCTGTGAATCTGGCATAAGATGG + Intronic
963297953 3:143567557-143567579 GCTTTTAGACATGCAAATGAAGG - Intronic
964250343 3:154708865-154708887 GGTGTAAAACAGGCAAAAGAAGG - Intergenic
967312631 3:188120506-188120528 GGTGTTAGTCAGACTTAAGAGGG + Intergenic
969334152 4:6497099-6497121 GCAGTCATTCAGGGAAAAGAGGG + Intronic
969821781 4:9726312-9726334 GCTGCTACTCTGGCTAAAGATGG - Intergenic
969969102 4:11027735-11027757 GCTCTAAGTCAAGGAAAAGATGG - Intergenic
971068446 4:23062105-23062127 GCAGTTACTCAGGCAAAATGAGG - Intergenic
976744142 4:88386818-88386840 GCTTTTAGGCAGGTAAGAGAGGG + Intronic
977468584 4:97413624-97413646 ACTCATATTCAGGCAAAAGATGG - Intronic
980965789 4:139519528-139519550 GCAGTTGCACAGGCAAAAGAGGG - Intronic
981633983 4:146854150-146854172 CCAGGGAGTCAGGCAAAAGAAGG - Intronic
982637918 4:157920213-157920235 GCAGTCATTCAGGCAAAAGATGG - Intergenic
984854601 4:184183954-184183976 GCTGGTAGACAGGGAAAGGAAGG - Intronic
986239848 5:5951309-5951331 GATGTCACTCAGGGAAAAGAGGG - Intergenic
988540040 5:32100367-32100389 GCTGGTAGGCAGGCAAGGGAGGG + Intronic
989860591 5:46371420-46371442 ACTGTGAGTGAGGCAGAAGATGG + Intergenic
990205927 5:53429680-53429702 TCTAATAGCCAGGCAAAAGAAGG + Intergenic
991910585 5:71557085-71557107 GCAGTTTGGTAGGCAAAAGAAGG + Intronic
993423321 5:87729983-87730005 GCTGTCAGTGAGGCAACAGATGG - Intergenic
993961623 5:94304373-94304395 GCTTTTAGCCTGGCAAGAGAGGG + Intronic
995478591 5:112572596-112572618 GCTTGTAGTCAGCCAAAAGTTGG - Intergenic
996505355 5:124262325-124262347 GTTTATAGTCAGGGAAAAGATGG - Intergenic
996566813 5:124888608-124888630 GCTGTTAGTGAAGGATAAGAGGG - Intergenic
997442423 5:133918309-133918331 GCTGTTTGGTAAGCAAAAGAGGG + Intergenic
998672151 5:144366183-144366205 GCTGTTAGTCATCAAAAAGCTGG + Intronic
999694510 5:154176900-154176922 GCTGTTACTAAGGAAAAATAGGG + Intronic
1004140297 6:13012006-13012028 GCTGGTAGTCCAGCAAAAGGGGG + Intronic
1004653392 6:17634133-17634155 GCTGTTACTCAAGCAAGAGATGG - Intronic
1005869691 6:29965603-29965625 GCTGTCAGTAAGGCAGCAGAAGG + Intergenic
1007271504 6:40640934-40640956 GCTGTGAGGCAGGCGAGAGAAGG + Intergenic
1007280399 6:40708146-40708168 GATGTTAGTCAGGCTAATGAAGG + Intergenic
1010381975 6:75235936-75235958 GCTGTTAGCCATGAAAACGATGG - Intergenic
1013872705 6:114786112-114786134 GCTGTCAGACTTGCAAAAGATGG + Intergenic
1013948675 6:115753087-115753109 GCTGTTTGCAAGCCAAAAGAGGG + Intergenic
1015445355 6:133297567-133297589 GGTGTTAGTAAGGCAAAACCAGG - Intronic
1018219338 6:161562718-161562740 GCTGTGGGTCAGGGAAAGGAAGG - Intronic
1020043464 7:5021932-5021954 CCTGCTACTTAGGCAAAAGACGG - Intronic
1020087501 7:5319129-5319151 GCTGTTAATAAGGCAGAAGTTGG - Intronic
1020316969 7:6912515-6912537 GCTGCTACTCTGGCTAAAGACGG + Intergenic
1021659567 7:22906729-22906751 GCTGTAAGTCAGGCAGAATCAGG - Intergenic
1022941257 7:35242097-35242119 GCTGCTAGTCATGCAACTGATGG + Intronic
1023044553 7:36199631-36199653 GCTGTCACTCAGTCAGAAGAGGG - Intronic
1023148547 7:37177742-37177764 GCAGTGAGTCAAGGAAAAGAAGG - Intronic
1024138638 7:46437674-46437696 GTTGTTTGTCATGCTAAAGAAGG + Intergenic
1027717606 7:81692733-81692755 GGCATTAGTCAGGCAAAAGCTGG + Intergenic
1028649741 7:93138484-93138506 GCTTTTTGTCAGACACAAGAAGG + Intronic
1029947994 7:104553749-104553771 GATGTTAGTATGGCAAAAGAGGG - Intronic
1031435378 7:121726621-121726643 GCTGGAAGTCAGGGAACAGATGG - Intergenic
1032506808 7:132441770-132441792 GCTGCCAGTCAGGGAAATGAAGG + Intronic
1036288472 8:7465470-7465492 GCTCTTTGACAGGCAAAAGCTGG + Intergenic
1036333003 8:7846058-7846080 GCTCTTTGACAGGCAAAAGCTGG - Intergenic
1038404068 8:27308988-27309010 GGTGTTAGCCAGGTGAAAGAGGG - Intronic
1039434960 8:37553685-37553707 ACTCTTAGTCAAGCAAAATAGGG + Intergenic
1040974387 8:53174094-53174116 GCTGTTAGTCATCCATGAGATGG + Intergenic
1041616688 8:59915543-59915565 GATGTTTGTCAGGGAGAAGAAGG - Intergenic
1046748073 8:117897292-117897314 GCTGGTAGTCATGCATCAGATGG + Intronic
1046872952 8:119223647-119223669 GCTGTTACTGAGGCAAAAGATGG + Intronic
1047243341 8:123115230-123115252 TCTGAGAGTCAGTCAAAAGATGG + Intronic
1047792617 8:128220088-128220110 GCAGTAATACAGGCAAAAGATGG + Intergenic
1048281560 8:133109371-133109393 GCTGTTATCCAGGCAAACTAGGG + Intronic
1049759158 8:144324138-144324160 GCTGTGAGGCAGGCAGGAGAGGG - Intronic
1051527906 9:18067837-18067859 GCTGTTATTGAAGCATAAGAGGG + Intergenic
1052184526 9:25575917-25575939 ACTGTTAAACAGGCAAGAGATGG - Intergenic
1056182921 9:84102861-84102883 GCTGTTGGTTAAGCAAGAGATGG - Intergenic
1056836766 9:89961797-89961819 GCTGTGATTCAGTCAGAAGACGG - Intergenic
1058575995 9:106401878-106401900 GGTGTTTTTCAGGCAAAAGATGG - Intergenic
1189024535 X:37378615-37378637 GCTGTTAGTTACACAATAGACGG + Intronic
1189440323 X:41030194-41030216 GCTGCCATTTAGGCAAAAGAGGG + Intergenic
1196376206 X:115035420-115035442 GCTGTTGATTAGGCAAGAGATGG - Intergenic
1196660740 X:118266195-118266217 GCTGTTAATGAGCAAAAAGAAGG + Intergenic
1198614910 X:138446156-138446178 TCTGCTAGCCATGCAAAAGATGG - Intergenic
1198965142 X:142220235-142220257 TGTGTTATTCAGGAAAAAGATGG + Intergenic
1199191381 X:144975407-144975429 GCAGTGAGTCAGGGAAAAAAGGG - Intergenic
1199635512 X:149808415-149808437 GCTGATGGTCAGGGAAAAGGAGG - Intergenic
1202119169 Y:21506864-21506886 GCAGTTTGGCAGGCAAAAGTGGG + Intergenic
1202121621 Y:21530404-21530426 GCAGTTTGGCAGGCAAAAGTGGG + Intronic
1202157384 Y:21898978-21899000 GCAGTTTGGCAGGCAAAAGTGGG - Intronic
1202159831 Y:21922519-21922541 GCAGTTTGGCAGGCAAAAGTGGG - Intergenic