ID: 950902993

View in Genome Browser
Species Human (GRCh38)
Location 3:16513695-16513717
Sequence CGGCGGGGGCGCGTCGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 0, 2: 13, 3: 109, 4: 851}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950902993_950903002 -2 Left 950902993 3:16513695-16513717 CCAGCCCCGACGCGCCCCCGCCG 0: 1
1: 0
2: 13
3: 109
4: 851
Right 950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG 0: 1
1: 0
2: 9
3: 83
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950902993 Original CRISPR CGGCGGGGGCGCGTCGGGGC TGG (reversed) Exonic