ID: 950902993 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:16513695-16513717 |
| Sequence | CGGCGGGGGCGCGTCGGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 974 | |||
| Summary | {0: 1, 1: 0, 2: 13, 3: 109, 4: 851} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950902993_950903002 | -2 | Left | 950902993 | 3:16513695-16513717 | CCAGCCCCGACGCGCCCCCGCCG | 0: 1 1: 0 2: 13 3: 109 4: 851 |
||
| Right | 950903002 | 3:16513716-16513738 | CGCCGCCGCCGCGCGTCCGCCGG | 0: 1 1: 0 2: 9 3: 83 4: 300 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950902993 | Original CRISPR | CGGCGGGGGCGCGTCGGGGC TGG (reversed) | Exonic | ||