ID: 950904095

View in Genome Browser
Species Human (GRCh38)
Location 3:16521817-16521839
Sequence CAAGGCTGCCTGCCAAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904095_950904101 4 Left 950904095 3:16521817-16521839 CCCGGTTTTGGCAGGCAGCCTTG No data
Right 950904101 3:16521844-16521866 AGAAACAGCTGGATGGCAATAGG No data
950904095_950904100 -3 Left 950904095 3:16521817-16521839 CCCGGTTTTGGCAGGCAGCCTTG No data
Right 950904100 3:16521837-16521859 TTGGCTGAGAAACAGCTGGATGG No data
950904095_950904098 -7 Left 950904095 3:16521817-16521839 CCCGGTTTTGGCAGGCAGCCTTG No data
Right 950904098 3:16521833-16521855 AGCCTTGGCTGAGAAACAGCTGG No data
950904095_950904102 9 Left 950904095 3:16521817-16521839 CCCGGTTTTGGCAGGCAGCCTTG No data
Right 950904102 3:16521849-16521871 CAGCTGGATGGCAATAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904095 Original CRISPR CAAGGCTGCCTGCCAAAACC GGG (reversed) Intergenic
No off target data available for this crispr