ID: 950904407

View in Genome Browser
Species Human (GRCh38)
Location 3:16524778-16524800
Sequence TATTCCCTTTCCTAGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904407_950904413 19 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904413 3:16524820-16524842 AAGAGGACTCACCCTGTAAGAGG No data
950904407_950904409 2 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904409 3:16524803-16524825 GACACCTCTGCCCTAATAAGAGG No data
950904407_950904416 28 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904407_950904414 20 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904414 3:16524821-16524843 AGAGGACTCACCCTGTAAGAGGG No data
950904407_950904415 21 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904407 Original CRISPR TATTCCCTTTCCTAGAATCT GGG (reversed) Intergenic
No off target data available for this crispr