ID: 950904408

View in Genome Browser
Species Human (GRCh38)
Location 3:16524779-16524801
Sequence ATATTCCCTTTCCTAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904408_950904414 19 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904414 3:16524821-16524843 AGAGGACTCACCCTGTAAGAGGG No data
950904408_950904413 18 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904413 3:16524820-16524842 AAGAGGACTCACCCTGTAAGAGG No data
950904408_950904416 27 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904408_950904415 20 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data
950904408_950904409 1 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904409 3:16524803-16524825 GACACCTCTGCCCTAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904408 Original CRISPR ATATTCCCTTTCCTAGAATC TGG (reversed) Intergenic
No off target data available for this crispr