ID: 950904409

View in Genome Browser
Species Human (GRCh38)
Location 3:16524803-16524825
Sequence GACACCTCTGCCCTAATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904404_950904409 6 Left 950904404 3:16524774-16524796 CCCACCCAGATTCTAGGAAAGGG No data
Right 950904409 3:16524803-16524825 GACACCTCTGCCCTAATAAGAGG No data
950904408_950904409 1 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904409 3:16524803-16524825 GACACCTCTGCCCTAATAAGAGG No data
950904407_950904409 2 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904409 3:16524803-16524825 GACACCTCTGCCCTAATAAGAGG No data
950904406_950904409 5 Left 950904406 3:16524775-16524797 CCACCCAGATTCTAGGAAAGGGA No data
Right 950904409 3:16524803-16524825 GACACCTCTGCCCTAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904409 Original CRISPR GACACCTCTGCCCTAATAAG AGG Intergenic
No off target data available for this crispr