ID: 950904410

View in Genome Browser
Species Human (GRCh38)
Location 3:16524807-16524829
Sequence GAGTCCTCTTATTAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904410_950904414 -9 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904414 3:16524821-16524843 AGAGGACTCACCCTGTAAGAGGG No data
950904410_950904419 4 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904419 3:16524834-16524856 TGTAAGAGGGGCATGTGGAATGG No data
950904410_950904420 5 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904420 3:16524835-16524857 GTAAGAGGGGCATGTGGAATGGG No data
950904410_950904416 -1 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904410_950904415 -8 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data
950904410_950904422 16 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data
950904410_950904421 8 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904421 3:16524838-16524860 AGAGGGGCATGTGGAATGGGAGG No data
950904410_950904413 -10 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904413 3:16524820-16524842 AAGAGGACTCACCCTGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904410 Original CRISPR GAGTCCTCTTATTAGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr