ID: 950904411

View in Genome Browser
Species Human (GRCh38)
Location 3:16524813-16524835
Sequence CAGGGTGAGTCCTCTTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904411_950904419 -2 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904419 3:16524834-16524856 TGTAAGAGGGGCATGTGGAATGG No data
950904411_950904420 -1 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904420 3:16524835-16524857 GTAAGAGGGGCATGTGGAATGGG No data
950904411_950904416 -7 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904411_950904421 2 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904421 3:16524838-16524860 AGAGGGGCATGTGGAATGGGAGG No data
950904411_950904422 10 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904411 Original CRISPR CAGGGTGAGTCCTCTTATTA GGG (reversed) Intergenic
No off target data available for this crispr