ID: 950904415

View in Genome Browser
Species Human (GRCh38)
Location 3:16524822-16524844
Sequence GAGGACTCACCCTGTAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904406_950904415 24 Left 950904406 3:16524775-16524797 CCACCCAGATTCTAGGAAAGGGA No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data
950904404_950904415 25 Left 950904404 3:16524774-16524796 CCCACCCAGATTCTAGGAAAGGG No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data
950904410_950904415 -8 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data
950904408_950904415 20 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data
950904407_950904415 21 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904415 3:16524822-16524844 GAGGACTCACCCTGTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904415 Original CRISPR GAGGACTCACCCTGTAAGAG GGG Intergenic
No off target data available for this crispr