ID: 950904416

View in Genome Browser
Species Human (GRCh38)
Location 3:16524829-16524851
Sequence CACCCTGTAAGAGGGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904408_950904416 27 Left 950904408 3:16524779-16524801 CCAGATTCTAGGAAAGGGAATAT No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904410_950904416 -1 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904411_950904416 -7 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904407_950904416 28 Left 950904407 3:16524778-16524800 CCCAGATTCTAGGAAAGGGAATA No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data
950904412_950904416 -8 Left 950904412 3:16524814-16524836 CCTAATAAGAGGACTCACCCTGT No data
Right 950904416 3:16524829-16524851 CACCCTGTAAGAGGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904416 Original CRISPR CACCCTGTAAGAGGGGCATG TGG Intergenic
No off target data available for this crispr