ID: 950904419

View in Genome Browser
Species Human (GRCh38)
Location 3:16524834-16524856
Sequence TGTAAGAGGGGCATGTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904410_950904419 4 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904419 3:16524834-16524856 TGTAAGAGGGGCATGTGGAATGG No data
950904412_950904419 -3 Left 950904412 3:16524814-16524836 CCTAATAAGAGGACTCACCCTGT No data
Right 950904419 3:16524834-16524856 TGTAAGAGGGGCATGTGGAATGG No data
950904411_950904419 -2 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904419 3:16524834-16524856 TGTAAGAGGGGCATGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904419 Original CRISPR TGTAAGAGGGGCATGTGGAA TGG Intergenic
No off target data available for this crispr