ID: 950904420

View in Genome Browser
Species Human (GRCh38)
Location 3:16524835-16524857
Sequence GTAAGAGGGGCATGTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904410_950904420 5 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904420 3:16524835-16524857 GTAAGAGGGGCATGTGGAATGGG No data
950904411_950904420 -1 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904420 3:16524835-16524857 GTAAGAGGGGCATGTGGAATGGG No data
950904412_950904420 -2 Left 950904412 3:16524814-16524836 CCTAATAAGAGGACTCACCCTGT No data
Right 950904420 3:16524835-16524857 GTAAGAGGGGCATGTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904420 Original CRISPR GTAAGAGGGGCATGTGGAAT GGG Intergenic
No off target data available for this crispr