ID: 950904422

View in Genome Browser
Species Human (GRCh38)
Location 3:16524846-16524868
Sequence ATGTGGAATGGGAGGTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904418_950904422 -9 Left 950904418 3:16524832-16524854 CCTGTAAGAGGGGCATGTGGAAT No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data
950904417_950904422 -8 Left 950904417 3:16524831-16524853 CCCTGTAAGAGGGGCATGTGGAA No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data
950904412_950904422 9 Left 950904412 3:16524814-16524836 CCTAATAAGAGGACTCACCCTGT No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data
950904410_950904422 16 Left 950904410 3:16524807-16524829 CCTCTGCCCTAATAAGAGGACTC No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data
950904411_950904422 10 Left 950904411 3:16524813-16524835 CCCTAATAAGAGGACTCACCCTG No data
Right 950904422 3:16524846-16524868 ATGTGGAATGGGAGGTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904422 Original CRISPR ATGTGGAATGGGAGGTATTA TGG Intergenic
No off target data available for this crispr