ID: 950904825

View in Genome Browser
Species Human (GRCh38)
Location 3:16528646-16528668
Sequence GGCCCACTGGGGACTGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904825_950904835 24 Left 950904825 3:16528646-16528668 CCAAACCCAGTCCCCAGTGGGCC No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904825_950904832 6 Left 950904825 3:16528646-16528668 CCAAACCCAGTCCCCAGTGGGCC No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904825 Original CRISPR GGCCCACTGGGGACTGGGTT TGG (reversed) Intergenic
No off target data available for this crispr