ID: 950904826

View in Genome Browser
Species Human (GRCh38)
Location 3:16528651-16528673
Sequence TAAGTGGCCCACTGGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904826_950904832 1 Left 950904826 3:16528651-16528673 CCCAGTCCCCAGTGGGCCACTTA No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904826_950904835 19 Left 950904826 3:16528651-16528673 CCCAGTCCCCAGTGGGCCACTTA No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904826 Original CRISPR TAAGTGGCCCACTGGGGACT GGG (reversed) Intergenic
No off target data available for this crispr