ID: 950904827

View in Genome Browser
Species Human (GRCh38)
Location 3:16528652-16528674
Sequence TTAAGTGGCCCACTGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904827_950904835 18 Left 950904827 3:16528652-16528674 CCAGTCCCCAGTGGGCCACTTAA No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904827_950904832 0 Left 950904827 3:16528652-16528674 CCAGTCCCCAGTGGGCCACTTAA No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904827 Original CRISPR TTAAGTGGCCCACTGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr