ID: 950904832

View in Genome Browser
Species Human (GRCh38)
Location 3:16528675-16528697
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904829_950904832 -6 Left 950904829 3:16528658-16528680 CCCAGTGGGCCACTTAACTTCCC No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904826_950904832 1 Left 950904826 3:16528651-16528673 CCCAGTCCCCAGTGGGCCACTTA No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904827_950904832 0 Left 950904827 3:16528652-16528674 CCAGTCCCCAGTGGGCCACTTAA No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904830_950904832 -7 Left 950904830 3:16528659-16528681 CCAGTGGGCCACTTAACTTCCCT No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904825_950904832 6 Left 950904825 3:16528646-16528668 CCAAACCCAGTCCCCAGTGGGCC No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904828_950904832 -5 Left 950904828 3:16528657-16528679 CCCCAGTGGGCCACTTAACTTCC No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904821_950904832 13 Left 950904821 3:16528639-16528661 CCAGGTCCCAAACCCAGTCCCCA No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data
950904824_950904832 7 Left 950904824 3:16528645-16528667 CCCAAACCCAGTCCCCAGTGGGC No data
Right 950904832 3:16528675-16528697 CTTCCCTCTCTTCATGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type