ID: 950904834

View in Genome Browser
Species Human (GRCh38)
Location 3:16528679-16528701
Sequence AACTCCTGAGTCATGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904834_950904835 -9 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904834_950904837 19 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904837 3:16528721-16528743 GTCTTGCACATGCATGCACTTGG No data
950904834_950904839 29 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904839 3:16528731-16528753 TGCATGCACTTGGCACAGAAGGG No data
950904834_950904838 28 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904838 3:16528730-16528752 ATGCATGCACTTGGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904834 Original CRISPR AACTCCTGAGTCATGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr