ID: 950904835

View in Genome Browser
Species Human (GRCh38)
Location 3:16528693-16528715
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904829_950904835 12 Left 950904829 3:16528658-16528680 CCCAGTGGGCCACTTAACTTCCC No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904831_950904835 3 Left 950904831 3:16528667-16528689 CCACTTAACTTCCCTCTCTTCAT No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904825_950904835 24 Left 950904825 3:16528646-16528668 CCAAACCCAGTCCCCAGTGGGCC No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904827_950904835 18 Left 950904827 3:16528652-16528674 CCAGTCCCCAGTGGGCCACTTAA No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904824_950904835 25 Left 950904824 3:16528645-16528667 CCCAAACCCAGTCCCCAGTGGGC No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904830_950904835 11 Left 950904830 3:16528659-16528681 CCAGTGGGCCACTTAACTTCCCT No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904826_950904835 19 Left 950904826 3:16528651-16528673 CCCAGTCCCCAGTGGGCCACTTA No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904833_950904835 -8 Left 950904833 3:16528678-16528700 CCCTCTCTTCATGACTCAGGAGT No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904834_950904835 -9 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data
950904828_950904835 13 Left 950904828 3:16528657-16528679 CCCCAGTGGGCCACTTAACTTCC No data
Right 950904835 3:16528693-16528715 TCAGGAGTTAGTCCTGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type