ID: 950904837

View in Genome Browser
Species Human (GRCh38)
Location 3:16528721-16528743
Sequence GTCTTGCACATGCATGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904833_950904837 20 Left 950904833 3:16528678-16528700 CCCTCTCTTCATGACTCAGGAGT No data
Right 950904837 3:16528721-16528743 GTCTTGCACATGCATGCACTTGG No data
950904836_950904837 -7 Left 950904836 3:16528705-16528727 CCTGTGACTGGCTGCAGTCTTGC No data
Right 950904837 3:16528721-16528743 GTCTTGCACATGCATGCACTTGG No data
950904834_950904837 19 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904837 3:16528721-16528743 GTCTTGCACATGCATGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904837 Original CRISPR GTCTTGCACATGCATGCACT TGG Intergenic
No off target data available for this crispr