ID: 950904838

View in Genome Browser
Species Human (GRCh38)
Location 3:16528730-16528752
Sequence ATGCATGCACTTGGCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950904834_950904838 28 Left 950904834 3:16528679-16528701 CCTCTCTTCATGACTCAGGAGTT No data
Right 950904838 3:16528730-16528752 ATGCATGCACTTGGCACAGAAGG No data
950904836_950904838 2 Left 950904836 3:16528705-16528727 CCTGTGACTGGCTGCAGTCTTGC No data
Right 950904838 3:16528730-16528752 ATGCATGCACTTGGCACAGAAGG No data
950904833_950904838 29 Left 950904833 3:16528678-16528700 CCCTCTCTTCATGACTCAGGAGT No data
Right 950904838 3:16528730-16528752 ATGCATGCACTTGGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950904838 Original CRISPR ATGCATGCACTTGGCACAGA AGG Intergenic
No off target data available for this crispr