ID: 950910782

View in Genome Browser
Species Human (GRCh38)
Location 3:16589077-16589099
Sequence CTGACTGAACTGCATCTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950910780_950910782 25 Left 950910780 3:16589029-16589051 CCCAAAGACAGCTGGTAGAAAAT 0: 5
1: 0
2: 2
3: 19
4: 324
Right 950910782 3:16589077-16589099 CTGACTGAACTGCATCTAATAGG 0: 1
1: 0
2: 0
3: 7
4: 99
950910781_950910782 24 Left 950910781 3:16589030-16589052 CCAAAGACAGCTGGTAGAAAATG 0: 5
1: 0
2: 1
3: 23
4: 228
Right 950910782 3:16589077-16589099 CTGACTGAACTGCATCTAATAGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950910782 Original CRISPR CTGACTGAACTGCATCTAAT AGG Intronic
900632238 1:3643436-3643458 CTCACTGAACCTCGTCTAATGGG + Intronic
901987657 1:13088989-13089011 CTGACTGAACAAAATCTCATAGG - Intergenic
901994155 1:13137778-13137800 CTGACTGAACAAAATCTCATAGG + Intergenic
904425653 1:30421238-30421260 CAGACTGAAATGAAGCTAATTGG + Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
913585291 1:120268967-120268989 TTAACTGAACTGAATCAAATTGG + Intergenic
913622894 1:120629395-120629417 TTAACTGAACTGAATCAAATTGG - Intergenic
914567293 1:148880828-148880850 TTAACTGAACTGAATCAAATTGG + Intronic
914605529 1:149249414-149249436 TTAACTGAACTGAATCAAATTGG - Intergenic
916343986 1:163767377-163767399 CAGAAGGAACTGCATCTTATGGG + Intergenic
916856391 1:168754735-168754757 CTCAAGGAACTGAATCTAATAGG - Intergenic
1064243105 10:13648358-13648380 CTGACTGAAAAACTTCTAATGGG + Intronic
1064516700 10:16157194-16157216 TTGACTAAACTGCATTTTATAGG - Intergenic
1070309467 10:75262835-75262857 CTGGCTGAACTTCCTCTACTCGG + Intergenic
1073556887 10:104462326-104462348 CTGAGTGAGCACCATCTAATTGG + Intergenic
1074981573 10:118624169-118624191 CTGTCTGCACTGCATCTGATTGG + Intergenic
1076414862 10:130278582-130278604 CTGACTTAACTGAATTTATTTGG - Intergenic
1081263819 11:40994385-40994407 CTGGCTGAACTGTAGCTAATGGG + Intronic
1081749509 11:45499779-45499801 CTGACTGACCTGCTTCACATTGG - Intergenic
1081820764 11:45992194-45992216 CTCACTGAACTGTAACTACTAGG + Intronic
1086030564 11:82350112-82350134 CTGACTGAAGTATATATAATGGG + Intergenic
1093127720 12:15350453-15350475 CTGATTGATATGCAGCTAATTGG - Intronic
1094275195 12:28667675-28667697 CTGTTTGAACTGAATCTGATTGG - Intergenic
1097383670 12:58923856-58923878 CTGTCTTATCTTCATCTAATTGG - Intergenic
1098875670 12:75864321-75864343 CTGTCTGAACTGCATAGAAGTGG - Intergenic
1101803051 12:108039304-108039326 CTGACTAGACTGCATGTTATTGG + Intergenic
1108506010 13:51112968-51112990 CTGACTGAACTTCTTCTCAGAGG + Intergenic
1109572372 13:64210109-64210131 GTGTTTGAACTGCATCTAAGTGG - Intergenic
1111029158 13:82573360-82573382 ATGACTGAATTGCATCTCATTGG + Intergenic
1111034433 13:82653807-82653829 CTGACTGAATTTTATCTATTAGG - Intergenic
1111213699 13:85115084-85115106 CTGATTTAATTGCATCTAATTGG - Intergenic
1111860987 13:93705690-93705712 CTGACCCAACTCCATGTAATTGG + Intronic
1113578698 13:111413158-111413180 CTGACAGAGCTGCAGCTCATGGG + Intergenic
1119962925 14:78880565-78880587 CTTTCTGGACTGCATCAAATGGG - Intronic
1120651460 14:87138632-87138654 CAGTCTGAATTACATCTAATTGG - Intergenic
1121971122 14:98357291-98357313 CTGAATGAAATCCATCTAAGTGG + Intergenic
1126864383 15:52921367-52921389 CTGCCTGAACTGCATCTAGGGGG + Intergenic
1127808928 15:62546395-62546417 CTGATTGAACAGCAACTATTTGG + Intronic
1128154522 15:65384330-65384352 CTGACTTTAGTGCATCTAACGGG - Exonic
1128428739 15:67570799-67570821 CTGACTGAGCTACATATAATAGG + Intronic
1131102157 15:89701273-89701295 GTGCTTGAACTGCATCTGATGGG + Intronic
1133133374 16:3692139-3692161 CTAAATGAACCGCATCTAACTGG + Intronic
1133690061 16:8204997-8205019 TTGAGTGACCTGCTTCTAATAGG + Intergenic
1141531905 16:84652217-84652239 CTGTCTGAACTGAATCTCTTAGG + Intronic
1142272259 16:89096252-89096274 CTGACTGAACTGCATTTGTCTGG + Intronic
1149122584 17:53187710-53187732 CTTACTTAACTGCATATCATAGG - Intergenic
1155454709 18:25998730-25998752 CTTACTGTACTACCTCTAATAGG + Intergenic
1156844725 18:41651891-41651913 CTGAATGAACTACATCTGACTGG - Intergenic
926993874 2:18712498-18712520 ATGTCTGAACTGGATCTAGTTGG - Intergenic
927065957 2:19471317-19471339 GTGACTGAAATTCATCTATTTGG + Intergenic
933553806 2:83807697-83807719 CTGACTGACCAGCTTCAAATTGG + Intergenic
938371408 2:130770812-130770834 CTGACTGAACGGAATCTGCTTGG - Intergenic
941852003 2:170193015-170193037 CTTATTGATGTGCATCTAATAGG + Intronic
943630084 2:190241530-190241552 ATGAAGAAACTGCATCTAATGGG - Intronic
945697212 2:213122204-213122226 GTGACTGAACTGCATCTTTAGGG - Intronic
945748563 2:213750719-213750741 TTTACTCAAGTGCATCTAATTGG - Intronic
1170634602 20:18093486-18093508 CTGTCTGAACTGCACCTGCTCGG - Intergenic
1172615947 20:36284545-36284567 CAGACTGCACTACATCAAATAGG - Intergenic
1179935338 21:44600394-44600416 CAAACTGAACGGCATCTCATAGG + Intronic
1182523864 22:30903277-30903299 CAGACTGAACTGCACCTTGTTGG + Intronic
1182636277 22:31729870-31729892 GTGACTGAACTGCATATTTTTGG + Intronic
950629963 3:14275780-14275802 CTGGCTGAACAGCATCACATGGG - Intergenic
950910782 3:16589077-16589099 CTGACTGAACTGCATCTAATAGG + Intronic
951263337 3:20538288-20538310 TTGACTGAACTGCAGTCAATAGG + Intergenic
953580849 3:44154911-44154933 CTGGCTGAATTGCATTTAACTGG + Intergenic
955741652 3:62097289-62097311 CATCCTGAACTGCATTTAATAGG - Intronic
957326890 3:78707236-78707258 CTGACTTAATTGCTACTAATGGG - Intronic
958888815 3:99760289-99760311 CTGACTGAAATGAATGTGATTGG - Intronic
964088106 3:152842668-152842690 CTGACAGAACTGCAACTCTTTGG + Intergenic
964503206 3:157370822-157370844 CTGACTGAACAGAATCTTATGGG + Intronic
966081578 3:176010436-176010458 CTGGCGGAACTGCATATAAGAGG + Intergenic
969715232 4:8865141-8865163 CTGACTGAACCGCCTGTAAGGGG + Intronic
970736717 4:19179140-19179162 CTGAGTGATCTGCATTTAGTTGG - Intergenic
972553917 4:40162094-40162116 CTCACTGGAGTGTATCTAATTGG + Intergenic
975112811 4:70645812-70645834 CTAACTGAACTGTGTCTACTTGG - Exonic
978713646 4:111815634-111815656 AGGACTGAACTGGAACTAATGGG - Intergenic
981891901 4:149748143-149748165 CTGACTGAAGAGGATCTCATGGG + Intergenic
988811737 5:34791963-34791985 CCTAATGAACTGCATCCAATGGG - Intronic
988842031 5:35092699-35092721 CTAACTGAACTGCAAATATTTGG - Intronic
990299436 5:54435932-54435954 CTCACTGAACTTCACTTAATGGG - Intergenic
990696887 5:58428149-58428171 GTGGCTCAACTGCATCTATTTGG + Intergenic
995805301 5:116045532-116045554 CTGACAGATCAGCATCTAAAAGG - Intronic
1005620216 6:27613348-27613370 CTCACTGAGATGCATCTATTGGG + Intergenic
1012725272 6:102802970-102802992 CTGAGTGAAATGCATGTAGTCGG - Intergenic
1023034791 7:36120823-36120845 CCAACTGAACTGCAGCTAAGGGG + Intergenic
1028446166 7:90926834-90926856 CTGACTGACCTGCTACAAATTGG + Intronic
1030442536 7:109605445-109605467 CTGACTTAACAGAAACTAATAGG - Intergenic
1034050353 7:147977448-147977470 CTGAAGGAACTGCTTCAAATAGG + Intronic
1038533779 8:28339344-28339366 CTCACTGAACCGCTTCTGATTGG - Exonic
1038922239 8:32097699-32097721 CTTCCTTAACTGCATCTATTTGG - Intronic
1039896543 8:41720403-41720425 TTAACTGAACTGCATTTGATAGG - Intronic
1040058744 8:43086241-43086263 CTCACTGCAGTGCATCTGATTGG + Intergenic
1041008808 8:53521633-53521655 CTGACTGAACAAAATCTTATGGG + Intergenic
1042430533 8:68701263-68701285 CTGTCTGAAATGCATTTTATTGG + Intronic
1043747538 8:83894497-83894519 CTGACTGAGCTGTCTCTAAGTGG - Intergenic
1049461909 8:142734164-142734186 CTGAATGAACTTCCTCCAATAGG - Intronic
1052701952 9:31948554-31948576 ATGACTGAATTAAATCTAATAGG + Intergenic
1052703065 9:31960699-31960721 CTGACTGACCTGCATCTCTCTGG + Intergenic
1053274399 9:36772291-36772313 CTTACTCAAGTGCATCTGATTGG + Intergenic
1057309759 9:93934694-93934716 CTGGCTGAACTGCAAGTACTGGG - Intergenic
1057711451 9:97449403-97449425 CTGACTGACCAGCTTCAAATTGG + Intronic
1062063705 9:134514588-134514610 CTGTCTGACCTGCATCTGAGGGG + Intergenic
1186952314 X:14640630-14640652 CTTACTGAACTTCATATAAATGG + Intronic
1190567742 X:51748024-51748046 CTCACTGAAATGCAAATAATTGG - Intergenic
1191852006 X:65592126-65592148 CTGACTGACCCGCATCTGCTTGG - Intronic
1199843715 X:151675623-151675645 CTGACTGATTTGCAGCTACTTGG - Intronic
1201339673 Y:12920669-12920691 CTGACTGATGTGAATCTAAAAGG + Intergenic